RchiOBHm_Chr5g0083591

Bacterial RNA polymerase, alpha chain C terminal domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
89305506 .. 89305664
159 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35772

Sequence Viewer

Length: 159 bp
ATGAATTTAAAAGAAATTGTATTGAGAAGTAATCTGTATGGAACTCGTAATGCGTCTATTTATGGCAAAGGTCCTGGGTATGTAACTGCTCAAGACATCATTTTACCACCCTATGTAGAAATTGTTGATAATACACAGCATATAGCTAACCTAACATAA

Protein Analysis

52

Amino Acids

5.78

Weight (kDa)

6.52

Isoelectric Point (pI)

32.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RNA_pol_A_bac PF01000 1 - 52 1.3e-06 RNA polymerase Rpb3/RpoA insert domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0026710)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00740
rosa_chinensis RchiOBHm_Chr5g0083591

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 4
AjnI CCWGG 1 cut(s) 73
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
ApoI RAATTY 1 cut(s) 4
AspS9I GGNCC 1 cut(s) 71
AvaII GGWCC 1 cut(s) 71
BciT130I CCWGG 1 cut(s) 75
Bme1390I CCNGG 1 cut(s) 75
Bme18I GGWCC 1 cut(s) 71
BmgT120I GGNCC 1 cut(s) 71
BmrFI CCNGG 1 cut(s) 75
BpuEI CTTGAG 1 cut(s) 75
BsaJI CCNNGG 1 cut(s) 74
BseBI CCWGG 1 cut(s) 75
BseDI CCNNGG 1 cut(s) 74
BssECI CCNNGG 1 cut(s) 74
Bst2UI CCWGG 1 cut(s) 75
BstNI CCWGG 1 cut(s) 75
BstSCI CCNGG 1 cut(s) 73
Cfr13I GGNCC 1 cut(s) 71
CseI GACGC 1 cut(s) 42
CviJI RGCY 1 cut(s) 146
CviKI_1 RGCY 1 cut(s) 146
DraI TTTAAA 1 cut(s) 9
Eco47I GGWCC 1 cut(s) 71
EcoO109I RGGNCCY 1 cut(s) 71
EcoRII CCWGG 1 cut(s) 73
FaiI YATR 7 cut(s) 39, 63, 81, 114, 141, 143, 157
FspEI CC 9 cut(s) 24, 48, 54, 60, 61, 87, 120, 123, 124
HgaI GACGC 1 cut(s) 42
Hpy188III TCNNGA 1 cut(s) 92
LpnPI CCDG 2 cut(s) 60, 87
MaeIII GTNAC 1 cut(s) 82
MluCI AATT 3 cut(s) 4, 15, 120
MseI TTAA 1 cut(s) 8
MspR9I CCNGG 1 cut(s) 75
MvaI CCWGG 1 cut(s) 75
PpuMI RGGWCCY 1 cut(s) 71
Psp5II RGGWCCY 1 cut(s) 71
Psp6I CCWGG 1 cut(s) 73
PspGI CCWGG 1 cut(s) 73
PspPI GGNCC 1 cut(s) 71
PspPPI RGGWCCY 1 cut(s) 71
SaqAI TTAA 1 cut(s) 8
Sau96I GGNCC 1 cut(s) 71
ScrFI CCNGG 1 cut(s) 75
SetI ASST 3 cut(s) 73, 148, 153
SgeI CNNG 4 cut(s) 57, 86, 87, 104
SinI GGWCC 1 cut(s) 71
SmlI CTYRAG 1 cut(s) 90
SmoI CTYRAG 1 cut(s) 90
Sse9I AATT 3 cut(s) 4, 15, 120
StyD4I CCNGG 1 cut(s) 73
TasI AATT 3 cut(s) 4, 15, 120
Tru1I TTAA 1 cut(s) 8
Tru9I TTAA 1 cut(s) 8
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 71
XapI RAATTY 1 cut(s) 4
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.