RchiOBHm_Chr6g0256051

Belongs to the UDP-glycosyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0030317
Physical Location & Seq
Reverse (-)
11442689 .. 11442947
259 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22966

Sequence Viewer

Length: 198 bp
ATGGAAAATAAGGGATTGATTATAAGAGATTGGGCCCCCCAACTGCTGATTCTTGAACATAAAGCCGTTGGAGCATTTCTCTGTCATTGTGGGTGGAAATCAATCCTTGGGGGAATACTTTGTGTTGGGGTTGCTGTTGGTGCAGAAAAATGGGTTTCATTTGTGGATGAAAGTTTGAAGAGCAAGGCCCGTATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00906 ko01100 ko01110 map00906 map01100 map01110
Pfam Domains
Protein Families
UDPGT

Protein Analysis

65

Amino Acids

7.12

Weight (kDa)

8.57

Isoelectric Point (pI)

25.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UDPGT PF00201 7 - 44 4.4e-06 UDP-glucoronosyl and UDP-glucosyl transferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030317)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0256051
rosa_rugosa Rorug05G0562600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 23
AgsI TTSAA 2 cut(s) 56, 178
AjuI GAANNNNNNNTTGG 2 cut(s) 33, 65
AoxI GGCC 2 cut(s) 33, 186
ApaI GGGCCC 1 cut(s) 37
AspS9I GGNCC 3 cut(s) 33, 34, 187
BaeGI GKGCMC 1 cut(s) 37
BanII GRGCYC 1 cut(s) 37
BceAI ACGGC 1 cut(s) 50
BmgT120I GGNCC 3 cut(s) 33, 34, 187
BmiI GGNNCC 2 cut(s) 35, 36
BplI GAGNNNNNCTC 2 cut(s) 63, 95
BsaJI CCNNGG 1 cut(s) 106
BseDI CCNNGG 1 cut(s) 106
BseGI GGATG 1 cut(s) 172
BseSI GKGCMC 1 cut(s) 37
BsgI GTGCAG 1 cut(s) 162
BshFI GGCC 2 cut(s) 35, 188
BsnI GGCC 2 cut(s) 35, 188
Bsp120I GGGCCC 1 cut(s) 33
Bsp1286I GDGCHC 1 cut(s) 37
BspANI GGCC 2 cut(s) 35, 188
BspLI GGNNCC 2 cut(s) 35, 36
BspQI GCTCTTC 1 cut(s) 173
BssECI CCNNGG 1 cut(s) 106
BssT1I CCWWGG 1 cut(s) 106
Bst6I CTCTTC 1 cut(s) 173
BstF5I GGATG 1 cut(s) 172
BstMWI GCNNNNNNNGC 2 cut(s) 71, 140
BstSLI GKGCMC 1 cut(s) 37
BsuRI GGCC 2 cut(s) 35, 188
BtsCI GGATG 1 cut(s) 172
Cfr13I GGNCC 3 cut(s) 33, 34, 187
CviJI RGCY 3 cut(s) 35, 65, 188
CviKI_1 RGCY 3 cut(s) 35, 65, 188
Eam1104I CTCTTC 1 cut(s) 173
EarI CTCTTC 1 cut(s) 173
Eco130I CCWWGG 1 cut(s) 106
Eco24I GRGCYC 1 cut(s) 37
EcoO109I RGGNCCY 1 cut(s) 34
EcoT14I CCWWGG 1 cut(s) 106
EcoT38I GRGCYC 1 cut(s) 37
ErhI CCWWGG 1 cut(s) 106
FaiI YATR 3 cut(s) 23, 60, 194
FokI GGATG 1 cut(s) 179
FriOI GRGCYC 1 cut(s) 37
HaeIII GGCC 2 cut(s) 35, 188
HinfI GANTC 1 cut(s) 49
Hpy188III TCNNGA 1 cut(s) 53
HpyCH4V TGCA 1 cut(s) 143
HpyF10VI GCNNNNNNNGC 2 cut(s) 71, 140
LguI GCTCTTC 1 cut(s) 173
LmnI GCTCC 1 cut(s) 71
MboII GAAGA 1 cut(s) 190
MhlI GDGCHC 1 cut(s) 37
MmeI TCCRAC 1 cut(s) 49
MwoI GCNNNNNNNGC 2 cut(s) 71, 140
NlaIV GGNNCC 2 cut(s) 35, 36
PciSI GCTCTTC 1 cut(s) 173
PfeI GAWTC 1 cut(s) 49
PsiI TTATAA 1 cut(s) 23
PspN4I GGNNCC 2 cut(s) 35, 36
PspOMI GGGCCC 1 cut(s) 33
PspPI GGNCC 3 cut(s) 33, 34, 187
SapI GCTCTTC 1 cut(s) 173
Sau96I GGNCC 3 cut(s) 33, 34, 187
SduI GDGCHC 1 cut(s) 37
SgeI CNNG 2 cut(s) 65, 119
StyI CCWWGG 1 cut(s) 106
TfiI GAWTC 1 cut(s) 49
TspDTI ATGAA 2 cut(s) 147, 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.