RchiOBHm_Chr6g0297941

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
59546440 .. 59546667
228 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ26743

Sequence Viewer

Length: 228 bp
ATGAAGAGAAACTCACCAGGATCTCTTGAAGCAACTTCAGAAGAGAATAGTATCTACGAAAATATGGCTGGTATGCCCGTCCGTTTCAGTTACAAGAATCTACAAACTGCAACGAATAACTTCTCAAAGAAGCTTGGGCAAGGAGGTTTTGGATCAGTTTATGAAGGAGTTCTTCCAGATGGAACCCAACTGGCTGTGAAGAAGTTGGAAGGAATTGGTCTGAAGTAA

Protein Analysis

75

Amino Acids

8.09

Weight (kDa)

9.05

Isoelectric Point (pI)

32.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030316)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0297941
rosa_rugosa Rorug06G0276900.1

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 28, 160
AcuI CTGAAG 1 cut(s) 21
AgsI TTSAA 1 cut(s) 29
AjnI CCWGG 1 cut(s) 16
AluBI AGCT 1 cut(s) 133
AluI AGCT 1 cut(s) 133
AlwI GGATC 2 cut(s) 28, 160
Asp700I GAANNNNTTC 2 cut(s) 119, 168
AsuHPI GGTGA 1 cut(s) 6
BccI CCATC 1 cut(s) 173
BciT130I CCWGG 1 cut(s) 18
Bme1390I CCNGG 1 cut(s) 18
BmiI GGNNCC 1 cut(s) 184
BmrFI CCNGG 1 cut(s) 18
Bse1I ACTGG 1 cut(s) 195
BseBI CCWGG 1 cut(s) 18
BseNI ACTGG 1 cut(s) 195
Bsp143I GATC 2 cut(s) 20, 152
BspLI GGNNCC 1 cut(s) 184
BspPI GGATC 2 cut(s) 28, 160
BsrI ACTGG 1 cut(s) 195
BssMI GATC 2 cut(s) 20, 152
Bst2UI CCWGG 1 cut(s) 18
Bst6I CTCTTC 1 cut(s) 36
BstKTI GATC 2 cut(s) 23, 155
BstMBI GATC 2 cut(s) 20, 152
BstNI CCWGG 1 cut(s) 18
BstSCI CCNGG 1 cut(s) 16
BstX2I RGATCY 1 cut(s) 20
BstYI RGATCY 1 cut(s) 20
CviJI RGCY 3 cut(s) 68, 133, 194
CviKI_1 RGCY 3 cut(s) 68, 133, 194
DpnI GATC 2 cut(s) 22, 154
DpnII GATC 2 cut(s) 20, 152
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
Eco57I CTGAAG 1 cut(s) 21
EcoRII CCWGG 1 cut(s) 16
FaiI YATR 3 cut(s) 65, 74, 162
FalI AAGNNNNNCTT 2 cut(s) 156, 188
HindIII AAGCTT 1 cut(s) 131
HinfI GANTC 1 cut(s) 97
HphI GGTGA 1 cut(s) 6
Hpy188I TCNGA 2 cut(s) 40, 222
Hpy188III TCNNGA 2 cut(s) 26, 176
HpyAV CCTTC 2 cut(s) 158, 203
HpyCH4V TGCA 1 cut(s) 110
Kzo9I GATC 2 cut(s) 20, 152
LpnPI CCDG 5 cut(s) 3, 30, 54, 176, 189
MaeIII GTNAC 1 cut(s) 89
MalI GATC 2 cut(s) 22, 154
MboI GATC 2 cut(s) 20, 152
MboII GAAGA 4 cut(s) 16, 53, 164, 211
MflI RGATCY 1 cut(s) 20
MluCI AATT 1 cut(s) 213
MmeI TCCRAC 1 cut(s) 186
MnlI CCTC 1 cut(s) 137
MroXI GAANNNNTTC 2 cut(s) 119, 168
MspR9I CCNGG 1 cut(s) 18
MvaI CCWGG 1 cut(s) 18
NdeII GATC 2 cut(s) 20, 152
NlaIV GGNNCC 1 cut(s) 184
PdmI GAANNNNTTC 2 cut(s) 119, 168
PfeI GAWTC 1 cut(s) 97
Psp6I CCWGG 1 cut(s) 16
PspGI CCWGG 1 cut(s) 16
PspN4I GGNNCC 1 cut(s) 184
PsuI RGATCY 1 cut(s) 20
Sau3AI GATC 2 cut(s) 20, 152
ScrFI CCNGG 1 cut(s) 18
SetI ASST 2 cut(s) 135, 148
Sse9I AATT 1 cut(s) 213
StyD4I CCNGG 1 cut(s) 16
TasI AATT 1 cut(s) 213
TfiI GAWTC 1 cut(s) 97
TspDTI ATGAA 2 cut(s) 17, 177
TspGWI ACGGA 1 cut(s) 71
XmnI GAANNNNTTC 2 cut(s) 119, 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.