RchiOBHm_Chr7g0229631
ERF Family

P-loop nucleoside triphosphate hydrolase superfamily protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0019961
Physical Location & Seq
Forward (+)
53189291 .. 53191338
2048 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20571

Sequence Viewer

Length: 339 bp
ATGATGGGTGGAAGTTCGATTGATGATGACTGGGAGCTTCCCTTTTCTAATGCTGCTTGCACTGTGGTCTTGGTTGGACGCACTGGTAATGGAAAAAGCGCAACAGGCAACAGCATTCTTGGCAAAAAAGCCTTCAATTCCAAGCGTATCTCTAATGGTGTCACGAGCACTTGTGAATTGAAGACTGCTATCTTGAGAGATGGACAAGAAGTTAATGTCCTGGTCTTTTTGAATATTCTGCCAGATCAAACTTTATTGGCAAAGAAATCTTCAAATGCATTAGTTTGTCTAAGGATGGGATCCATGCTGTTCTTGTGGACTTGTGGTTTTCTCAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AIG1

Protein Analysis

112

Amino Acids

11.97

Weight (kDa)

8.82

Isoelectric Point (pI)

35.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AIG1 PF04548 20 - 74 3.1e-19 AIG1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019961)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0229631 RchiOBHm_Chr7g0229901 RchiOBHm_Chr7g0230011
rosa_multiflora Rmu_sc0002666.1_g000016 Rmu_sc0002738.1_g000002
rosa_samantha Rh7DG403700
rosa_wichuraiana Rw7G033960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 294, 307
AgsI TTSAA 4 cut(s) 136, 181, 232, 273
AjnI CCWGG 1 cut(s) 219
AluBI AGCT 1 cut(s) 37
AluI AGCT 1 cut(s) 37
Alw21I GWGCWC 1 cut(s) 170
AlwI GGATC 2 cut(s) 294, 307
ApeKI GCWGC 1 cut(s) 53
AspLEI GCGC 1 cut(s) 101
BamHI GGATCC 1 cut(s) 299
BauI CACGAG 1 cut(s) 163
BbsI GAAGAC 1 cut(s) 188
Bbv12I GWGCWC 1 cut(s) 170
BbvI GCAGC 1 cut(s) 40
BccI CCATC 2 cut(s) 194, 289
BciT130I CCWGG 1 cut(s) 221
BfaI CTAG 1 cut(s) 337
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
Bme1390I CCNGG 1 cut(s) 221
BmiI GGNNCC 1 cut(s) 301
BmrFI CCNGG 1 cut(s) 221
BmrI ACTGGG 1 cut(s) 40
BmuI ACTGGG 1 cut(s) 40
BpiI GAAGAC 1 cut(s) 188
BpuEI CTTGAG 1 cut(s) 214
Bse1I ACTGG 2 cut(s) 35, 88
BseBI CCWGG 1 cut(s) 221
BseGI GGATG 1 cut(s) 300
BseNI ACTGG 2 cut(s) 35, 88
BseXI GCAGC 1 cut(s) 40
BsiHKAI GWGCWC 1 cut(s) 170
BsmI GAATGC 1 cut(s) 114
Bsp1286I GDGCHC 1 cut(s) 170
Bsp143I GATC 2 cut(s) 244, 299
BspLI GGNNCC 1 cut(s) 301
BspPI GGATC 2 cut(s) 294, 307
BsrI ACTGG 2 cut(s) 35, 88
BssMI GATC 2 cut(s) 244, 299
BssSI CACGAG 1 cut(s) 163
Bst2BI CACGAG 1 cut(s) 163
Bst2UI CCWGG 1 cut(s) 221
Bst4CI ACNGT 1 cut(s) 64
BstC8I GCNNGC 1 cut(s) 58
BstDEI CTNAG 1 cut(s) 290
BstF5I GGATG 1 cut(s) 300
BstHHI GCGC 1 cut(s) 101
BstKTI GATC 2 cut(s) 247, 302
BstMBI GATC 2 cut(s) 244, 299
BstMWI GCNNNNNNNGC 2 cut(s) 105, 120
BstNI CCWGG 1 cut(s) 221
BstSCI CCNGG 1 cut(s) 219
BstV1I GCAGC 1 cut(s) 40
BstV2I GAAGAC 1 cut(s) 188
BstX2I RGATCY 1 cut(s) 299
BstYI RGATCY 1 cut(s) 299
BtsCI GGATG 1 cut(s) 300
BtsIMutI CAGTG 2 cut(s) 60, 81
Cac8I GCNNGC 1 cut(s) 58
CfoI GCGC 1 cut(s) 101
CseI GACGC 1 cut(s) 87
CviAII CATG 1 cut(s) 304
CviJI RGCY 2 cut(s) 37, 131
CviKI_1 RGCY 2 cut(s) 37, 131
DdeI CTNAG 1 cut(s) 290
DpnI GATC 2 cut(s) 246, 301
DpnII GATC 2 cut(s) 244, 299
EcoRII CCWGG 1 cut(s) 219
EcoT22I ATGCAT 1 cut(s) 280
FaeI CATG 1 cut(s) 307
FaiI YATR 1 cut(s) 305
FatI CATG 1 cut(s) 303
Fnu4HI GCNGC 1 cut(s) 54
FokI GGATG 1 cut(s) 307
Fsp4HI GCNGC 1 cut(s) 54
FspBI CTAG 1 cut(s) 337
GlaI GCGC 1 cut(s) 100
GluI GCNGC 1 cut(s) 54
HgaI GACGC 1 cut(s) 87
HhaI GCGC 1 cut(s) 101
Hin1II CATG 1 cut(s) 307
Hin6I GCGC 1 cut(s) 99
HinP1I GCGC 1 cut(s) 99
Hpy166II GTNNAC 1 cut(s) 318
Hpy188III TCNNGA 2 cut(s) 163, 193
Hpy8I GTNNAC 1 cut(s) 318
HpyAV CCTTC 1 cut(s) 142
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 2 cut(s) 60, 278
HpyF10VI GCNNNNNNNGC 2 cut(s) 105, 120
HpyF3I CTNAG 1 cut(s) 290
Hsp92II CATG 1 cut(s) 307
HspAI GCGC 1 cut(s) 99
Kzo9I GATC 2 cut(s) 244, 299
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 6 cut(s) 16, 69, 90, 206, 233, 255
Lsp1109I GCAGC 1 cut(s) 40
MaeI CTAG 1 cut(s) 337
MaeIII GTNAC 1 cut(s) 160
MalI GATC 2 cut(s) 246, 301
MboI GATC 2 cut(s) 244, 299
MboII GAAGA 2 cut(s) 193, 261
MflI RGATCY 1 cut(s) 299
MhlI GDGCHC 1 cut(s) 170
MluCI AATT 2 cut(s) 136, 176
MmeI TCCRAC 1 cut(s) 55
Mph1103I ATGCAT 1 cut(s) 280
MseI TTAA 1 cut(s) 213
MspR9I CCNGG 1 cut(s) 221
Mva1269I GAATGC 1 cut(s) 114
MvaI CCWGG 1 cut(s) 221
MwoI GCNNNNNNNGC 2 cut(s) 105, 120
NdeII GATC 2 cut(s) 244, 299
NlaIII CATG 1 cut(s) 307
NlaIV GGNNCC 1 cut(s) 301
NmuCI GTSAC 1 cut(s) 160
NsiI ATGCAT 1 cut(s) 280
PctI GAATGC 1 cut(s) 114
PkrI GCNGC 1 cut(s) 55
Psp6I CCWGG 1 cut(s) 219
PspGI CCWGG 1 cut(s) 219
PspN4I GGNNCC 1 cut(s) 301
PsuI RGATCY 1 cut(s) 299
SaqAI TTAA 1 cut(s) 213
SatI GCNGC 1 cut(s) 54
Sau3AI GATC 2 cut(s) 244, 299
ScrFI CCNGG 1 cut(s) 221
SduI GDGCHC 1 cut(s) 170
SetI ASST 1 cut(s) 39
SmlI CTYRAG 1 cut(s) 193
SmoI CTYRAG 1 cut(s) 193
Sse9I AATT 2 cut(s) 136, 176
SspI AATATT 1 cut(s) 235
SspMI CTAG 1 cut(s) 337
StyD4I CCNGG 1 cut(s) 219
TaaI ACNGT 1 cut(s) 64
TaqI TCGA 1 cut(s) 17
TasI AATT 2 cut(s) 136, 176
Tru1I TTAA 1 cut(s) 213
Tru9I TTAA 1 cut(s) 213
TscAI CASTG 2 cut(s) 67, 88
TseFI GTSAC 1 cut(s) 160
TseI GCWGC 1 cut(s) 53
Tsp45I GTSAC 1 cut(s) 160
TspRI CASTG 2 cut(s) 67, 88
XspI CTAG 1 cut(s) 337
Zsp2I ATGCAT 1 cut(s) 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.