RchiOBHm_Chr7g0238101

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
63457925 .. 63458164
240 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21338

Sequence Viewer

Length: 153 bp
ATGAGGTATTTCTCAAGGATAGAATACCAAACTGGGTTGCCGGTTCTGGATATGTGGCCCTGGTTCGACAAACTACCTAAAGTAAAACCGCTTCCGGCGTACCTAAACAACCGGGTGAGGTTGAGTGTGGCTATTATGTTATGCGATACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.99

Weight (kDa)

9.43

Isoelectric Point (pI)

32.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030024)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0411261 RchiOBHm_Chr7g0238101

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 89
AfaI GTAC 1 cut(s) 101
AjnI CCWGG 1 cut(s) 59
AoxI GGCC 1 cut(s) 56
AspS9I GGNCC 1 cut(s) 57
AsuC2I CCSGG 1 cut(s) 113
AsuHPI GGTGA 1 cut(s) 127
BarI GAAGNNNNNNTAC 2 cut(s) 75, 107
BciT130I CCWGG 1 cut(s) 61
BcnI CCSGG 1 cut(s) 113
Bme1390I CCNGG 2 cut(s) 61, 113
BmgT120I GGNCC 1 cut(s) 57
BmrFI CCNGG 2 cut(s) 61, 113
BmrI ACTGGG 1 cut(s) 42
BmuI ACTGGG 1 cut(s) 42
BpuMI CCSGG 1 cut(s) 113
BsaJI CCNNGG 1 cut(s) 59
Bse118I RCCGGY 1 cut(s) 40
Bse1I ACTGG 1 cut(s) 37
BseBI CCWGG 1 cut(s) 61
BseDI CCNNGG 1 cut(s) 59
BseNI ACTGG 1 cut(s) 37
BshFI GGCC 1 cut(s) 58
BsiSI CCGG 3 cut(s) 41, 95, 112
BsnI GGCC 1 cut(s) 58
BspACI CCGC 1 cut(s) 89
BspANI GGCC 1 cut(s) 58
BsrFI RCCGGY 1 cut(s) 40
BsrI ACTGG 1 cut(s) 37
BssAI RCCGGY 1 cut(s) 40
BssECI CCNNGG 1 cut(s) 59
Bst2UI CCWGG 1 cut(s) 61
BstNI CCWGG 1 cut(s) 61
BstSCI CCNGG 2 cut(s) 59, 111
BsuRI GGCC 1 cut(s) 58
Cfr10I RCCGGY 1 cut(s) 40
Cfr13I GGNCC 1 cut(s) 57
Csp6I GTAC 1 cut(s) 100
CviAII CATG 1 cut(s) 150
CviJI RGCY 2 cut(s) 58, 131
CviKI_1 RGCY 2 cut(s) 58, 131
CviQI GTAC 1 cut(s) 100
EcoRII CCWGG 1 cut(s) 59
FaeI CATG 1 cut(s) 153
FaiI YATR 4 cut(s) 53, 137, 142, 151
FatI CATG 1 cut(s) 149
HaeIII GGCC 1 cut(s) 58
HapII CCGG 3 cut(s) 41, 95, 112
Hin1II CATG 1 cut(s) 153
HpaII CCGG 3 cut(s) 41, 95, 112
HphI GGTGA 1 cut(s) 127
Hpy188III TCNNGA 1 cut(s) 47
Hsp92II CATG 1 cut(s) 153
LpnPI CCDG 7 cut(s) 18, 32, 46, 54, 73, 108, 125
MnlI CCTC 1 cut(s) 111
MspI CCGG 3 cut(s) 41, 95, 112
MspR9I CCNGG 2 cut(s) 61, 113
MvaI CCWGG 1 cut(s) 61
NciI CCSGG 1 cut(s) 113
NlaIII CATG 1 cut(s) 153
Psp6I CCWGG 1 cut(s) 59
PspGI CCWGG 1 cut(s) 59
PspPI GGNCC 1 cut(s) 57
RsaI GTAC 1 cut(s) 101
RsaNI GTAC 1 cut(s) 100
Sau96I GGNCC 1 cut(s) 57
ScrFI CCNGG 2 cut(s) 61, 113
SetI ASST 4 cut(s) 8, 79, 105, 122
SgeI CNNG 9 cut(s) 27, 45, 53, 59, 72, 73, 107, 124, 125
SmlI CTYRAG 1 cut(s) 13
SmoI CTYRAG 1 cut(s) 13
SsiI CCGC 1 cut(s) 89
StyD4I CCNGG 2 cut(s) 59, 111
TaqI TCGA 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.