RCHIOBHM_MTG0499281

Ribosomal protein S13

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
Mt
OG0022278
Physical Location & Seq
Reverse (-)
303406 .. 303756
351 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ15667

Sequence Viewer

Length: 351 bp
ATGTCATATATTTCAGGAGCTAGATCAGTTGCCGATGAACAAGTAAGAATTGCCTCAACAAAAATTGATGGAATTGGACCTAAAAAAGCCATTCAGGTTCGTTATCGATTAGGTATCAGTGGGAACATAAAGATAAAAGAGTTAACTAAGTATCAGATCGACCAAATTGAACAAATGATAGGTCAAGATCATGTTGTTCATTGGGAATTGAAGAGGGGAGAACGAGCAGACATCGAACGATTAATTTCTATTTCTTGTTATCGTGGAATTCGTCATCAAGATGGATTGCCCTTACGCGGGCAACGAACTCATACTAATGCAAGGACTTTTCGCAAGCTAATTCGGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S13

Protein Analysis

116

Amino Acids

13.38

Weight (kDa)

10.32

Isoelectric Point (pI)

27.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S13 PF00416 6 - 109 2e-29 Ribosomal protein S13/S18
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022278)

Species Orthologous Gene IDs
fragaria_vesca FvH4_c1g00301
rosa_chinensis RchiOBHm_MTg0499281
rosa_roxburghii Rroxscaffold_2G00119280
rosa_wichuraiana Rw0G023280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 297
AciI CCGC 1 cut(s) 297
AcsI RAATTY 1 cut(s) 267
AfiI CCNNNNNNNGG 2 cut(s) 296, 297
AgsI TTSAA 2 cut(s) 170, 211
AluBI AGCT 2 cut(s) 20, 337
AluI AGCT 2 cut(s) 20, 337
ApoI RAATTY 1 cut(s) 267
ArsI GACNNNNNNTTYG 2 cut(s) 166, 198
AseI ATTAAT 1 cut(s) 242
AspS9I GGNCC 1 cut(s) 77
AvaII GGWCC 1 cut(s) 77
BccI CCATC 2 cut(s) 62, 275
BfaI CTAG 1 cut(s) 21
Bme18I GGWCC 1 cut(s) 77
BmgT120I GGNCC 1 cut(s) 77
Bsa29I ATCGAT 1 cut(s) 106
Bsc4I CCNNNNNNNGG 2 cut(s) 296, 297
BseCI ATCGAT 1 cut(s) 106
BseLI CCNNNNNNNGG 2 cut(s) 296, 297
Bsh1236I CGCG 1 cut(s) 297
BshVI ATCGAT 1 cut(s) 106
BslI CCNNNNNNNGG 2 cut(s) 296, 297
Bsp143I GATC 3 cut(s) 23, 156, 187
BspACI CCGC 1 cut(s) 297
BspDI ATCGAT 1 cut(s) 106
BspFNI CGCG 1 cut(s) 297
BssMI GATC 3 cut(s) 23, 156, 187
Bst6I CTCTTC 1 cut(s) 206
BstC8I GCNNGC 2 cut(s) 299, 335
BstDEI CTNAG 1 cut(s) 147
BstFNI CGCG 1 cut(s) 297
BstKTI GATC 3 cut(s) 26, 159, 190
BstMBI GATC 3 cut(s) 23, 156, 187
BstUI CGCG 1 cut(s) 297
Bsu15I ATCGAT 1 cut(s) 106
BsuTUI ATCGAT 1 cut(s) 106
BtsIMutI CAGTG 1 cut(s) 124
Cac8I GCNNGC 2 cut(s) 299, 335
Cfr13I GGNCC 1 cut(s) 77
ClaI ATCGAT 1 cut(s) 106
CviAII CATG 1 cut(s) 191
CviJI RGCY 3 cut(s) 20, 89, 337
CviKI_1 RGCY 3 cut(s) 20, 89, 337
DdeI CTNAG 1 cut(s) 147
DpnI GATC 3 cut(s) 25, 158, 189
DpnII GATC 3 cut(s) 23, 156, 187
Eam1104I CTCTTC 1 cut(s) 206
EarI CTCTTC 1 cut(s) 206
Eco47I GGWCC 1 cut(s) 77
EcoRI GAATTC 1 cut(s) 267
FaeI CATG 1 cut(s) 194
FaiI YATR 5 cut(s) 7, 9, 128, 192, 312
FatI CATG 1 cut(s) 190
FauI CCCGC 1 cut(s) 290
FspBI CTAG 1 cut(s) 21
Hin1II CATG 1 cut(s) 194
HincII GTYRAC 1 cut(s) 144
HindII GTYRAC 1 cut(s) 144
HpaI GTTAAC 1 cut(s) 144
Hpy166II GTNNAC 1 cut(s) 144
Hpy188I TCNGA 2 cut(s) 156, 345
Hpy188III TCNNGA 3 cut(s) 15, 185, 278
Hpy8I GTNNAC 1 cut(s) 144
HpyCH4V TGCA 1 cut(s) 320
HpyF3I CTNAG 1 cut(s) 147
Hsp92II CATG 1 cut(s) 194
KspAI GTTAAC 1 cut(s) 144
Kzo9I GATC 3 cut(s) 23, 156, 187
LmnI GCTCC 1 cut(s) 17
LpnPI CCDG 1 cut(s) 80
MaeI CTAG 1 cut(s) 21
MalI GATC 3 cut(s) 25, 158, 189
MboI GATC 3 cut(s) 23, 156, 187
MboII GAAGA 1 cut(s) 223
MluCI AATT 8 cut(s) 48, 63, 72, 165, 206, 243, 267, 339
MnlI CCTC 2 cut(s) 64, 207
MseI TTAA 2 cut(s) 143, 242
MslI CAYNNNNRTG 2 cut(s) 279, 315
MvnI CGCG 1 cut(s) 297
NdeII GATC 3 cut(s) 23, 156, 187
NlaIII CATG 1 cut(s) 194
PcsI WCGNNNNNNNCGW 2 cut(s) 268, 301
PshBI ATTAAT 1 cut(s) 242
PspPI GGNCC 1 cut(s) 77
RseI CAYNNNNRTG 2 cut(s) 279, 315
SaqAI TTAA 2 cut(s) 143, 242
Sau3AI GATC 3 cut(s) 23, 156, 187
Sau96I GGNCC 1 cut(s) 77
SetI ASST 6 cut(s) 22, 82, 99, 115, 184, 339
SinI GGWCC 1 cut(s) 77
SmiMI CAYNNNNRTG 2 cut(s) 279, 315
Sse9I AATT 8 cut(s) 48, 63, 72, 165, 206, 243, 267, 339
SsiI CCGC 1 cut(s) 297
SspMI CTAG 1 cut(s) 21
TaqI TCGA 3 cut(s) 106, 159, 234
TasI AATT 8 cut(s) 48, 63, 72, 165, 206, 243, 267, 339
Tru1I TTAA 2 cut(s) 143, 242
Tru9I TTAA 2 cut(s) 143, 242
TscAI CASTG 1 cut(s) 124
TspDTI ATGAA 2 cut(s) 51, 188
TspRI CASTG 1 cut(s) 124
VpaK11BI GGWCC 1 cut(s) 77
VspI ATTAAT 1 cut(s) 242
XapI RAATTY 1 cut(s) 267
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.