Rmu_co8270105.1_g000001

The B regulatory subunit might modulate substrate selectivity and catalytic activity, and also might direct the localization of the catalytic enzyme to a particular subcellular compartment

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8270105.1
Physical Location & Seq
Reverse (-)
71 .. 418
348 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8270105.1_g000001.1.cds

Sequence Viewer

Length: 348 bp
ctgttcttatggaataatgatcacatttcaaacttaatcaaacagaatcgccatgttttactgcccatcatattcccttcgttggagagaaatgcaagaaatcactggaaccaggcagttcagagcctaacactaaatgtccgcaagatattctctgatattgaccctgagctttttgaggaatgcttgctcaaattccaggaagatgaagcacaagagaaggaaatgagtttgaaacgtgaattgacttggaaacgtttggaagagattgctgcaaagaaagcttctgcaagtaatgaagcggtgcttgtgtccccaagaaaagccatgggcaagccttctggctag

Protein Analysis

115

Amino Acids

13.35

Weight (kDa)

8.09

Isoelectric Point (pI)

59.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029484)

Species Orthologous Gene IDs
pyrus_communis pycom17g01490
rosa_multiflora Rmu_co8270105.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 142, 302
AclI AACGTT 1 cut(s) 256
AcsI RAATTY 1 cut(s) 194
AfiI CCNNNNNNNGG 1 cut(s) 82
AgsI TTSAA 2 cut(s) 30, 235
AjnI CCWGG 2 cut(s) 111, 198
AluBI AGCT 2 cut(s) 172, 284
AluI AGCT 2 cut(s) 172, 284
ApeKI GCWGC 1 cut(s) 272
ApoI RAATTY 1 cut(s) 194
BbvI GCAGC 1 cut(s) 259
BccI CCATC 1 cut(s) 74
BciT130I CCWGG 2 cut(s) 113, 200
BclI TGATCA 1 cut(s) 19
BfaI CTAG 1 cut(s) 346
BisI GCNGC 1 cut(s) 273
BlsI GCNGC 1 cut(s) 274
Bme1390I CCNGG 2 cut(s) 113, 200
BmiI GGNNCC 1 cut(s) 110
BmrFI CCNGG 2 cut(s) 113, 200
Bpu10I CCTNAGC 1 cut(s) 168
BsaJI CCNNGG 1 cut(s) 327
Bsc4I CCNNNNNNNGG 1 cut(s) 82
Bse1I ACTGG 1 cut(s) 110
BseBI CCWGG 2 cut(s) 113, 200
BseDI CCNNGG 1 cut(s) 327
BseLI CCNNNNNNNGG 1 cut(s) 82
BseMII CTCAG 1 cut(s) 159
BseNI ACTGG 1 cut(s) 110
BseXI GCAGC 1 cut(s) 259
BslFI GGGAC 1 cut(s) 298
BslI CCNNNNNNNGG 1 cut(s) 82
BsmFI GGGAC 1 cut(s) 298
BsmI GAATGC 1 cut(s) 188
Bsp143I GATC 1 cut(s) 19
Bsp19I CCATGG 1 cut(s) 327
BspACI CCGC 2 cut(s) 142, 302
BspCNI CTCAG 1 cut(s) 160
BspLI GGNNCC 1 cut(s) 110
BsrI ACTGG 1 cut(s) 110
BssECI CCNNGG 1 cut(s) 327
BssMI GATC 1 cut(s) 19
BssT1I CCWWGG 1 cut(s) 327
Bst2UI CCWGG 2 cut(s) 113, 200
Bst6I CTCTTC 1 cut(s) 258
BstC8I GCNNGC 2 cut(s) 188, 335
BstDEI CTNAG 1 cut(s) 168
BstDSI CCRYGG 1 cut(s) 327
BstKTI GATC 1 cut(s) 22
BstMBI GATC 1 cut(s) 19
BstMWI GCNNNNNNNGC 1 cut(s) 281
BstNI CCWGG 2 cut(s) 113, 200
BstSCI CCNGG 2 cut(s) 111, 198
BstV1I GCAGC 1 cut(s) 259
BtgI CCRYGG 1 cut(s) 327
BtsIMutI CAGTG 1 cut(s) 103
Cac8I GCNNGC 2 cut(s) 188, 335
CviAII CATG 2 cut(s) 53, 328
CviJI RGCY 6 cut(s) 126, 172, 284, 326, 337, 345
CviKI_1 RGCY 6 cut(s) 126, 172, 284, 326, 337, 345
DdeI CTNAG 1 cut(s) 168
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
Eam1104I CTCTTC 1 cut(s) 258
EarI CTCTTC 1 cut(s) 258
Eco130I CCWWGG 1 cut(s) 327
EcoRII CCWGG 2 cut(s) 111, 198
EcoT14I CCWWGG 1 cut(s) 327
ErhI CCWWGG 1 cut(s) 327
FaeI CATG 2 cut(s) 56, 331
FaiI YATR 4 cut(s) 10, 54, 71, 329
FalI AAGNNNNNCTT 2 cut(s) 291, 323
FaqI GGGAC 1 cut(s) 298
FatI CATG 2 cut(s) 52, 327
FbaI TGATCA 1 cut(s) 19
Fnu4HI GCNGC 1 cut(s) 273
Fsp4HI GCNGC 1 cut(s) 273
FspBI CTAG 1 cut(s) 346
GluI GCNGC 1 cut(s) 273
Hin1II CATG 2 cut(s) 56, 331
HindIII AAGCTT 1 cut(s) 282
HinfI GANTC 1 cut(s) 46
Hpy188I TCNGA 2 cut(s) 123, 157
HpyAV CCTTC 3 cut(s) 87, 214, 348
HpyCH4IV ACGT 2 cut(s) 238, 256
HpyCH4V TGCA 3 cut(s) 95, 275, 290
HpyF10VI GCNNNNNNNGC 1 cut(s) 281
HpyF3I CTNAG 1 cut(s) 168
HpySE526I ACGT 2 cut(s) 238, 256
Hsp92II CATG 2 cut(s) 56, 331
Ksp22I TGATCA 1 cut(s) 19
Kzo9I GATC 1 cut(s) 19
LpnPI CCDG 7 cut(s) 91, 98, 125, 180, 185, 212, 327
Lsp1109I GCAGC 1 cut(s) 259
MaeI CTAG 1 cut(s) 346
MaeII ACGT 2 cut(s) 238, 256
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MboII GAAGA 2 cut(s) 215, 275
MluCI AATT 2 cut(s) 194, 242
MmeI TCCRAC 1 cut(s) 63
MnlI CCTC 1 cut(s) 172
MseI TTAA 1 cut(s) 35
MspR9I CCNGG 2 cut(s) 113, 200
Mva1269I GAATGC 1 cut(s) 188
MvaI CCWGG 2 cut(s) 113, 200
MwoI GCNNNNNNNGC 1 cut(s) 281
NcoI CCATGG 1 cut(s) 327
NdeII GATC 1 cut(s) 19
NlaIII CATG 2 cut(s) 56, 331
NlaIV GGNNCC 1 cut(s) 110
PctI GAATGC 1 cut(s) 188
PfeI GAWTC 1 cut(s) 46
PfoI TCCNGGA 1 cut(s) 198
PkrI GCNGC 1 cut(s) 274
Psp1406I AACGTT 1 cut(s) 256
Psp6I CCWGG 2 cut(s) 111, 198
PspGI CCWGG 2 cut(s) 111, 198
PspN4I GGNNCC 1 cut(s) 110
SaqAI TTAA 1 cut(s) 35
SatI GCNGC 1 cut(s) 273
Sau3AI GATC 1 cut(s) 19
ScrFI CCNGG 2 cut(s) 113, 200
SetI ASST 4 cut(s) 174, 241, 259, 286
Sse9I AATT 2 cut(s) 194, 242
SsiI CCGC 2 cut(s) 142, 302
SspMI CTAG 1 cut(s) 346
StyD4I CCNGG 2 cut(s) 111, 198
StyI CCWWGG 1 cut(s) 327
TaiI ACGT 2 cut(s) 241, 259
TasI AATT 2 cut(s) 194, 242
TfiI GAWTC 1 cut(s) 46
Tru1I TTAA 1 cut(s) 35
Tru9I TTAA 1 cut(s) 35
TscAI CASTG 1 cut(s) 110
TseI GCWGC 1 cut(s) 272
TspDTI ATGAA 2 cut(s) 222, 312
TspRI CASTG 1 cut(s) 110
XapI RAATTY 1 cut(s) 194
XspI CTAG 1 cut(s) 346
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.