Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8295193.1

Orthogroup ID

OG0029362

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 638

Gene Structure 638 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8295193.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 315 bp

agtccagattatgtcagaaagtttgaaatttcagaagacaggttctggaaagatggtcagcctttccagatcattgggggtgacttgcattattttcgggttcttcctgagtactgggaagataggctgttgagagcaaaggcgctgggattaaatactattcaaacttatgtaccctggaacctgcatgaacccagagctggtacttcgaattttgagggtattgcagatttagtgtcatttctcgaactctgccagaagcttgggtttgctgttatgcttagacctgggccatatatatgtggaggtcagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004553 GO:0004565 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0015925 GO:0016787 GO:0016798 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko00052 ko00511 ko00531 ko00600 ko00604 ko01100 ko04142 map00052 map00511 map00531 map00600 map00604 map01100 map04142

Pfam Domains

Protein Families

BetaGal_dom4_5 Glyco_hydro_35

Protein Analysis

104

Amino Acids

12.01

Weight (kDa)

5.6

Isoelectric Point (pI)

35.38

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029362)

Species	Orthologous Gene IDs
pyrus_communis	pycom09g10900
rosa_multiflora	Rmu_co8295193.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	192
AcsI	RAATTY	2 cut(s)	27, 211
AfaI	GTAC	3 cut(s)	113, 174, 205
AfiI	CCNNNNNNNGG	1 cut(s)	200
AgsI	TTSAA	2 cut(s)	26, 164
AjnI	CCWGG	2 cut(s)	176, 286
AluBI	AGCT	2 cut(s)	200, 262
AluI	AGCT	2 cut(s)	200, 262
AlwNI	CAGNNNCTG	1 cut(s)	45
AoxI	GGCC	1 cut(s)	290
ApoI	RAATTY	2 cut(s)	27, 211
AspLEI	GCGC	1 cut(s)	145
AspS9I	GGNCC	1 cut(s)	290
AsuHPI	GGTGA	1 cut(s)	92
AsuII	TTCGAA	1 cut(s)	209
BaeI	ACNNNNGTAYC	2 cut(s)	156, 189
BbsI	GAAGAC	1 cut(s)	42
BccI	CCATC	1 cut(s)	47
BcgI	CGANNNNNNTGC	2 cut(s)	77, 111
BciT130I	CCWGG	2 cut(s)	178, 288
BfoI	RGCGCY	1 cut(s)	146
BfuAI	ACCTGC	1 cut(s)	192
BmcAI	AGTACT	1 cut(s)	113
Bme1390I	CCNGG	2 cut(s)	178, 288
BmgT120I	GGNCC	1 cut(s)	290
BmiI	GGNNCC	1 cut(s)	182
BmrFI	CCNGG	2 cut(s)	178, 288
BmrI	ACTGGG	1 cut(s)	124
BmuI	ACTGGG	1 cut(s)	124
BpiI	GAAGAC	1 cut(s)	42
Bpu14I	TTCGAA	1 cut(s)	209
BsaJI	CCNNGG	2 cut(s)	176, 287
Bsc4I	CCNNNNNNNGG	1 cut(s)	200
Bse1I	ACTGG	1 cut(s)	119
BseBI	CCWGG	2 cut(s)	178, 288
BseDI	CCNNGG	2 cut(s)	176, 287
BseLI	CCNNNNNNNGG	1 cut(s)	200
BseMII	CTCAG	1 cut(s)	99
BseNI	ACTGG	1 cut(s)	119
BseYI	CCCAGC	1 cut(s)	145
BshFI	GGCC	1 cut(s)	292
BslI	CCNNNNNNNGG	1 cut(s)	200
BsnI	GGCC	1 cut(s)	292
Bsp119I	TTCGAA	1 cut(s)	209
Bsp143I	GATC	1 cut(s)	69
BspANI	GGCC	1 cut(s)	292
BspCNI	CTCAG	1 cut(s)	100
BspLI	GGNNCC	1 cut(s)	182
BspMI	ACCTGC	1 cut(s)	192
BspT104I	TTCGAA	1 cut(s)	209
BsrI	ACTGG	1 cut(s)	119
BssECI	CCNNGG	2 cut(s)	176, 287
BssMI	GATC	1 cut(s)	69
Bst2UI	CCWGG	2 cut(s)	178, 288
BstBI	TTCGAA	1 cut(s)	209
BstDEI	CTNAG	2 cut(s)	108, 281
BstH2I	RGCGCY	1 cut(s)	146
BstHHI	GCGC	1 cut(s)	145
BstKTI	GATC	1 cut(s)	72
BstMBI	GATC	1 cut(s)	69
BstNI	CCWGG	2 cut(s)	178, 288
BstSCI	CCNGG	2 cut(s)	176, 286
BstV2I	GAAGAC	1 cut(s)	42
BstXI	CCANNNNNNTGG	2 cut(s)	74, 263
BsuRI	GGCC	1 cut(s)	292
BveI	ACCTGC	1 cut(s)	192
CaiI	CAGNNNCTG	1 cut(s)	45
CfoI	GCGC	1 cut(s)	145
Cfr13I	GGNCC	1 cut(s)	290
Csp6I	GTAC	3 cut(s)	112, 173, 204
CviAII	CATG	1 cut(s)	188
CviJI	RGCY	5 cut(s)	61, 127, 200, 262, 292
CviKI_1	RGCY	5 cut(s)	61, 127, 200, 262, 292
CviQI	GTAC	3 cut(s)	112, 173, 204
DdeI	CTNAG	2 cut(s)	108, 281
DpnI	GATC	1 cut(s)	71
DpnII	GATC	1 cut(s)	69
EcoRII	CCWGG	2 cut(s)	176, 286
FaeI	CATG	1 cut(s)	191
FaiI	YATR	8 cut(s)	12, 171, 189, 278, 295, 297, 299, 301
FatI	CATG	1 cut(s)	187
GlaI	GCGC	1 cut(s)	144
GsaI	CCCAGC	1 cut(s)	149
HaeII	RGCGCY	1 cut(s)	146
HaeIII	GGCC	1 cut(s)	292
HhaI	GCGC	1 cut(s)	145
Hin1II	CATG	1 cut(s)	191
Hin6I	GCGC	1 cut(s)	143
HinP1I	GCGC	1 cut(s)	143
HindIII	AAGCTT	1 cut(s)	260
HphI	GGTGA	1 cut(s)	92
Hpy188I	TCNGA	2 cut(s)	17, 34
Hpy188III	TCNNGA	5 cut(s)	5, 46, 67, 107, 245
HpyCH4V	TGCA	3 cut(s)	88, 187, 227
HpyF3I	CTNAG	2 cut(s)	108, 281
Hsp92II	CATG	1 cut(s)	191
HspAI	GCGC	1 cut(s)	143
Kzo9I	GATC	1 cut(s)	69
MaeIII	GTNAC	1 cut(s)	80
MalI	GATC	1 cut(s)	71
MboI	GATC	1 cut(s)	69
MboII	GAAGA	3 cut(s)	47, 95, 131
MluCI	AATT	2 cut(s)	27, 211
MnlI	CCTC	2 cut(s)	211, 299
MseI	TTAA	1 cut(s)	152
MslI	CAYNNNNRTG	1 cut(s)	298
MspR9I	CCNGG	2 cut(s)	178, 288
MvaI	CCWGG	2 cut(s)	178, 288
NdeII	GATC	1 cut(s)	69
NlaIII	CATG	1 cut(s)	191
NlaIV	GGNNCC	1 cut(s)	182
NmuCI	GTSAC	1 cut(s)	80
NspV	TTCGAA	1 cut(s)	209
Psp6I	CCWGG	2 cut(s)	176, 286
PspFI	CCCAGC	1 cut(s)	145
PspGI	CCWGG	2 cut(s)	176, 286
PspN4I	GGNNCC	1 cut(s)	182
PspPI	GGNCC	1 cut(s)	290
PstNI	CAGNNNCTG	1 cut(s)	45
RsaI	GTAC	3 cut(s)	113, 174, 205
RsaNI	GTAC	3 cut(s)	112, 173, 204
RseI	CAYNNNNRTG	1 cut(s)	298
SaqAI	TTAA	1 cut(s)	152
Sau3AI	GATC	1 cut(s)	69
Sau96I	GGNCC	1 cut(s)	290
ScaI	AGTACT	1 cut(s)	113
ScrFI	CCNGG	2 cut(s)	178, 288
SetI	ASST	6 cut(s)	44, 186, 202, 264, 289, 310
SfuI	TTCGAA	1 cut(s)	209
SmiMI	CAYNNNNRTG	1 cut(s)	298
Sse9I	AATT	2 cut(s)	27, 211
StyD4I	CCNGG	2 cut(s)	176, 286
TaqI	TCGA	2 cut(s)	209, 246
TasI	AATT	2 cut(s)	27, 211
TatI	WGTACW	1 cut(s)	111
Tru1I	TTAA	1 cut(s)	152
Tru9I	TTAA	1 cut(s)	152
TseFI	GTSAC	1 cut(s)	80
Tsp45I	GTSAC	1 cut(s)	80
TspDTI	ATGAA	1 cut(s)	204
XapI	RAATTY	2 cut(s)	27, 211
ZrmI	AGTACT	1 cut(s)	113

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.