Rmu_co8314229.1_g000001

At1g04910-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8314229.1
OG0029303
Physical Location & Seq
Reverse (-)
2 .. 285
284 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8314229.1_g000001.1.cds

Sequence Viewer

Length: 284 bp
atgtgcaaggtggagaaggagagaagaggagtgatggggataaaggggctgggaggtggagataagctgaagaactcgctgctgcaaacgacgtcgtccaggtcgagaatgaagctgtggatgataagggccacgacgtcggttttgctctggacgtgcgtcgtgcaattgacggccttgggggatatgtgggggcctagggttttgaagggatggccgtcctgcttctctcaggagagtgccgtggcctcctcggttttgcaggaccggatgatttccgttcc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
O-FucT

Protein Analysis

95

Amino Acids

10.49

Weight (kDa)

10.15

Isoelectric Point (pI)

47.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029303)

Species Orthologous Gene IDs
pyrus_communis pycom06g18390
rosa_multiflora Rmu_co8314229.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 2 cut(s) 95, 140
AcoI YGGCCR 1 cut(s) 215
AcuI CTGAAG 1 cut(s) 89
AcyI GRCGYC 2 cut(s) 92, 137
AgsI TTSAA 1 cut(s) 208
AjiI CACGTC 1 cut(s) 156
AjnI CCWGG 1 cut(s) 98
AluBI AGCT 2 cut(s) 67, 115
AluI AGCT 2 cut(s) 67, 115
AoxI GGCC 5 cut(s) 129, 174, 194, 215, 246
ApeKI GCWGC 2 cut(s) 79, 82
ArsI GACNNNNNNTTYG 2 cut(s) 127, 159
AspA2I CCTAGG 1 cut(s) 197
AspS9I GGNCC 3 cut(s) 129, 194, 265
AvaII GGWCC 1 cut(s) 265
AvrII CCTAGG 1 cut(s) 197
BbvI GCAGC 2 cut(s) 66, 69
BccI CCATC 2 cut(s) 28, 207
BceAI ACGGC 3 cut(s) 189, 202, 227
BciT130I CCWGG 1 cut(s) 100
BfaI CTAG 1 cut(s) 198
BisI GCNGC 2 cut(s) 80, 83
BlnI CCTAGG 1 cut(s) 197
BlsI GCNGC 2 cut(s) 81, 84
Bme1390I CCNGG 1 cut(s) 100
Bme18I GGWCC 1 cut(s) 265
BmgBI CACGTC 1 cut(s) 156
BmgT120I GGNCC 3 cut(s) 129, 194, 265
BmiI GGNNCC 1 cut(s) 195
BmrFI CCNGG 1 cut(s) 100
BoxI GACNNNNGTC 1 cut(s) 158
BsaHI GRCGYC 2 cut(s) 92, 137
BsaJI CCNNGG 4 cut(s) 177, 197, 243, 252
BsaWI WCCGGW 1 cut(s) 267
BseBI CCWGG 1 cut(s) 100
BseDI CCNNGG 4 cut(s) 177, 197, 243, 252
BseGI GGATG 3 cut(s) 126, 218, 276
BseMII CTCAG 1 cut(s) 245
BseRI GAGGAG 2 cut(s) 42, 241
BseXI GCAGC 2 cut(s) 66, 69
BseYI CCCAGC 1 cut(s) 49
BshFI GGCC 5 cut(s) 131, 176, 196, 217, 248
BsiSI CCGG 1 cut(s) 268
BsnI GGCC 5 cut(s) 131, 176, 196, 217, 248
BspANI GGCC 5 cut(s) 131, 176, 196, 217, 248
BspCNI CTCAG 1 cut(s) 244
BspLI GGNNCC 1 cut(s) 195
BssECI CCNNGG 4 cut(s) 177, 197, 243, 252
BssNI GRCGYC 2 cut(s) 92, 137
BssT1I CCWWGG 2 cut(s) 177, 197
Bst2UI CCWGG 1 cut(s) 100
Bst6I CTCTTC 1 cut(s) 19
BstACI GRCGYC 2 cut(s) 92, 137
BstDEI CTNAG 1 cut(s) 231
BstDSI CCRYGG 1 cut(s) 243
BstF5I GGATG 3 cut(s) 126, 218, 276
BstNI CCWGG 1 cut(s) 100
BstPAI GACNNNNGTC 1 cut(s) 158
BstSCI CCNGG 1 cut(s) 98
BstV1I GCAGC 2 cut(s) 66, 69
BsuRI GGCC 5 cut(s) 131, 176, 196, 217, 248
BtgI CCRYGG 1 cut(s) 243
BtrI CACGTC 1 cut(s) 156
BtsCI GGATG 3 cut(s) 126, 218, 276
Cfr13I GGNCC 3 cut(s) 129, 194, 265
CseI GACGC 1 cut(s) 148
CviJI RGCY 8 cut(s) 49, 67, 115, 131, 176, 196, 217, 248
CviKI_1 RGCY 8 cut(s) 49, 67, 115, 131, 176, 196, 217, 248
DdeI CTNAG 1 cut(s) 231
EaeI YGGCCR 1 cut(s) 215
Eam1104I CTCTTC 1 cut(s) 19
EarI CTCTTC 1 cut(s) 19
Eco130I CCWWGG 2 cut(s) 177, 197
Eco47I GGWCC 1 cut(s) 265
Eco57I CTGAAG 1 cut(s) 89
EcoO109I RGGNCCY 1 cut(s) 194
EcoRII CCWGG 1 cut(s) 98
EcoT14I CCWWGG 2 cut(s) 177, 197
ErhI CCWWGG 2 cut(s) 177, 197
FaiI YATR 1 cut(s) 188
Fnu4HI GCNGC 2 cut(s) 80, 83
FokI GGATG 2 cut(s) 133, 225
Fsp4HI GCNGC 2 cut(s) 80, 83
FspBI CTAG 1 cut(s) 198
GluI GCNGC 2 cut(s) 80, 83
GsaI CCCAGC 1 cut(s) 53
HaeIII GGCC 5 cut(s) 131, 176, 196, 217, 248
HapII CCGG 1 cut(s) 268
HgaI GACGC 1 cut(s) 148
Hin1I GRCGYC 2 cut(s) 92, 137
HpaII CCGG 1 cut(s) 268
Hpy188III TCNNGA 3 cut(s) 105, 151, 233
Hpy99I CGWCG 5 cut(s) 94, 97, 139, 142, 164
HpyAV CCTTC 2 cut(s) 10, 202
HpyCH4IV ACGT 3 cut(s) 92, 137, 155
HpyCH4V TGCA 4 cut(s) 6, 85, 166, 262
HpyF3I CTNAG 1 cut(s) 231
HpySE526I ACGT 3 cut(s) 92, 137, 155
Hsp92I GRCGYC 2 cut(s) 92, 137
LpnPI CCDG 7 cut(s) 35, 85, 112, 136, 218, 235, 248
Lsp1109I GCAGC 2 cut(s) 66, 69
MaeI CTAG 1 cut(s) 198
MaeII ACGT 3 cut(s) 92, 137, 155
MboII GAAGA 2 cut(s) 36, 82
MfeI CAATTG 1 cut(s) 167
MluCI AATT 1 cut(s) 167
MnlI CCTC 4 cut(s) 20, 47, 259, 262
MspI CCGG 1 cut(s) 268
MspR9I CCNGG 1 cut(s) 100
MunI CAATTG 1 cut(s) 167
MvaI CCWGG 1 cut(s) 100
NlaIV GGNNCC 1 cut(s) 195
PcsI WCGNNNNNNNCGW 1 cut(s) 101
PflFI GACNNNGTC 1 cut(s) 94
PkrI GCNGC 2 cut(s) 81, 84
PshAI GACNNNNGTC 1 cut(s) 158
Psp6I CCWGG 1 cut(s) 98
PspFI CCCAGC 1 cut(s) 49
PspGI CCWGG 1 cut(s) 98
PspN4I GGNNCC 1 cut(s) 195
PspPI GGNCC 3 cut(s) 129, 194, 265
PsyI GACNNNGTC 1 cut(s) 94
SatI GCNGC 2 cut(s) 80, 83
Sau96I GGNCC 3 cut(s) 129, 194, 265
ScrFI CCNGG 1 cut(s) 100
SetI ASST 8 cut(s) 12, 58, 69, 95, 104, 117, 140, 158
SinI GGWCC 1 cut(s) 265
Sse9I AATT 1 cut(s) 167
SspMI CTAG 1 cut(s) 198
StyD4I CCNGG 1 cut(s) 98
StyI CCWWGG 2 cut(s) 177, 197
TaiI ACGT 3 cut(s) 95, 140, 158
TaqI TCGA 1 cut(s) 104
TasI AATT 1 cut(s) 167
TseI GCWGC 2 cut(s) 79, 82
TspDTI ATGAA 1 cut(s) 125
TspGWI ACGGA 1 cut(s) 268
Tth111I GACNNNGTC 1 cut(s) 94
VpaK11BI GGWCC 1 cut(s) 265
XmaJI CCTAGG 1 cut(s) 197
XspI CTAG 1 cut(s) 198
ZraI GACGTC 2 cut(s) 93, 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.