Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8326589.1

Orthogroup ID

OG0029492

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 935

Gene Structure 935 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8326589.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 258 bp

gttgatgtggatatagcaacccgtatacgcatttatgacgacggccccaaccgaagtttgcttactgtggagtcagctgatcgccctggattactggtggatcttgtaaggattataactgacattagcgttgctgttgagtcaggagaatttgacaccgaggggatgttggccaaagcaaagtttcatgttagctataggggtaaacctatcatcaagcctctccagcaggtaagcttacaatatggaaatgtttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006950 GO:0008150 GO:0009266 GO:0009314 GO:0009409 GO:0009416 GO:0009507 GO:0009526 GO:0009532 GO:0009534 GO:0009535 GO:0009536 GO:0009570 GO:0009579 GO:0009628 GO:0009719 GO:0009725 GO:0009735 GO:0009743 GO:0009744 GO:0009941 GO:0010033 GO:0010319 GO:0016020 GO:0031967 GO:0031975 GO:0031976 GO:0031984 GO:0034285 GO:0034357 GO:0042221 GO:0042651 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044436 GO:0044444 GO:0044446 GO:0044464 GO:0050896 GO:0055035 GO:1901700

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

85

Amino Acids

9.38

Weight (kDa)

5.2

Isoelectric Point (pI)

17.91

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029492)

Species	Orthologous Gene IDs
pyrus_communis	pycom17g23200
rosa_multiflora	Rmu_co8326589.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	116
Acc36I	ACCTGC	1 cut(s)	220
AccI	GTMKAC	1 cut(s)	25
AclWI	GGATC	1 cut(s)	108
AcoI	YGGCCR	1 cut(s)	171
AcsI	RAATTY	1 cut(s)	149
AjnI	CCWGG	1 cut(s)	85
AluBI	AGCT	3 cut(s)	77, 195, 237
AluI	AGCT	3 cut(s)	77, 195, 237
AlwI	GGATC	1 cut(s)	108
AoxI	GGCC	2 cut(s)	43, 171
ApoI	RAATTY	1 cut(s)	149
AspS9I	GGNCC	1 cut(s)	44
BalI	TGGCCA	1 cut(s)	173
BarI	GAAGNNNNNNTAC	2 cut(s)	46, 78
BceAI	ACGGC	1 cut(s)	58
BciT130I	CCWGG	1 cut(s)	87
BfmI	CTRYAG	1 cut(s)	196
BfuAI	ACCTGC	1 cut(s)	220
Bme1390I	CCNGG	1 cut(s)	87
BmgT120I	GGNCC	1 cut(s)	44
BmiI	GGNNCC	1 cut(s)	46
BmrFI	CCNGG	1 cut(s)	87
BpmI	CTGGAG	1 cut(s)	209
BsaJI	CCNNGG	2 cut(s)	85, 159
Bse1I	ACTGG	1 cut(s)	99
BseBI	CCWGG	1 cut(s)	87
BseDI	CCNNGG	2 cut(s)	85, 159
BseGI	GGATG	1 cut(s)	171
BseNI	ACTGG	1 cut(s)	99
BshFI	GGCC	2 cut(s)	45, 173
BsnI	GGCC	2 cut(s)	45, 173
Bsp143I	GATC	2 cut(s)	79, 100
BspANI	GGCC	2 cut(s)	45, 173
BspLI	GGNNCC	1 cut(s)	46
BspMI	ACCTGC	1 cut(s)	220
BspPI	GGATC	1 cut(s)	108
BsrI	ACTGG	1 cut(s)	99
BssECI	CCNNGG	2 cut(s)	85, 159
BssMI	GATC	2 cut(s)	79, 100
BssNAI	GTATAC	1 cut(s)	26
Bst1107I	GTATAC	1 cut(s)	26
Bst2UI	CCWGG	1 cut(s)	87
Bst4CI	ACNGT	1 cut(s)	67
BstF5I	GGATG	1 cut(s)	171
BstKTI	GATC	2 cut(s)	82, 103
BstMBI	GATC	2 cut(s)	79, 100
BstMWI	GCNNNNNNNGC	1 cut(s)	226
BstNI	CCWGG	1 cut(s)	87
BstSCI	CCNGG	1 cut(s)	85
BstSFI	CTRYAG	1 cut(s)	196
BstX2I	RGATCY	1 cut(s)	100
BstYI	RGATCY	1 cut(s)	100
BstZ17I	GTATAC	1 cut(s)	26
BsuRI	GGCC	2 cut(s)	45, 173
BtsCI	GGATG	1 cut(s)	171
BveI	ACCTGC	1 cut(s)	220
Cfr13I	GGNCC	1 cut(s)	44
CviAII	CATG	1 cut(s)	188
CviJI	RGCY	6 cut(s)	45, 77, 173, 195, 220, 237
CviKI_1	RGCY	6 cut(s)	45, 77, 173, 195, 220, 237
DpnI	GATC	2 cut(s)	81, 102
DpnII	GATC	2 cut(s)	79, 100
EaeI	YGGCCR	1 cut(s)	171
EcoRII	CCWGG	1 cut(s)	85
FaeI	CATG	1 cut(s)	191
FaiI	YATR	7 cut(s)	14, 26, 36, 116, 189, 198, 246
FatI	CATG	1 cut(s)	187
FblI	GTMKAC	1 cut(s)	25
FokI	GGATG	1 cut(s)	178
GsuI	CTGGAG	1 cut(s)	209
HaeIII	GGCC	2 cut(s)	45, 173
Hin1II	CATG	1 cut(s)	191
HindIII	AAGCTT	1 cut(s)	235
HinfI	GANTC	2 cut(s)	71, 140
Hpy166II	GTNNAC	2 cut(s)	26, 206
Hpy188III	TCNNGA	1 cut(s)	144
Hpy8I	GTNNAC	2 cut(s)	26, 206
Hpy99I	CGWCG	1 cut(s)	44
HpyCH4III	ACNGT	1 cut(s)	67
HpyF10VI	GCNNNNNNNGC	1 cut(s)	226
Hsp92II	CATG	1 cut(s)	191
Kzo9I	GATC	2 cut(s)	79, 100
LpnPI	CCDG	6 cut(s)	72, 80, 99, 129, 215, 239
MalI	GATC	2 cut(s)	81, 102
MboI	GATC	2 cut(s)	79, 100
MflI	RGATCY	1 cut(s)	100
MlsI	TGGCCA	1 cut(s)	173
MluCI	AATT	1 cut(s)	149
MluNI	TGGCCA	1 cut(s)	173
MlyI	GAGTC	2 cut(s)	80, 149
MnlI	CCTC	2 cut(s)	154, 231
Mox20I	TGGCCA	1 cut(s)	173
MscI	TGGCCA	1 cut(s)	173
Msp20I	TGGCCA	1 cut(s)	173
MspA1I	CMGCKG	1 cut(s)	77
MspR9I	CCNGG	1 cut(s)	87
MvaI	CCWGG	1 cut(s)	87
MwoI	GCNNNNNNNGC	1 cut(s)	226
NdeII	GATC	2 cut(s)	79, 100
NlaIII	CATG	1 cut(s)	191
NlaIV	GGNNCC	1 cut(s)	46
PleI	GAGTC	2 cut(s)	79, 148
PpsI	GAGTC	2 cut(s)	79, 148
PsiI	TTATAA	1 cut(s)	116
Psp6I	CCWGG	1 cut(s)	85
PspGI	CCWGG	1 cut(s)	85
PspN4I	GGNNCC	1 cut(s)	46
PspPI	GGNCC	1 cut(s)	44
PsuI	RGATCY	1 cut(s)	100
PvuII	CAGCTG	1 cut(s)	77
Sau3AI	GATC	2 cut(s)	79, 100
Sau96I	GGNCC	1 cut(s)	44
SchI	GAGTC	2 cut(s)	80, 149
ScrFI	CCNGG	1 cut(s)	87
SetI	ASST	5 cut(s)	79, 197, 211, 234, 239
SfcI	CTRYAG	1 cut(s)	196
Sse9I	AATT	1 cut(s)	149
StyD4I	CCNGG	1 cut(s)	85
TaaI	ACNGT	1 cut(s)	67
TasI	AATT	1 cut(s)	149
TspDTI	ATGAA	1 cut(s)	176
XapI	RAATTY	1 cut(s)	149
XmiI	GTMKAC	1 cut(s)	25

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.