Rmu_co8345901.1_g000001

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8345901.1
OG0031244
Physical Location & Seq
Reverse (-)
49 .. 567
519 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8345901.1_g000001.1.cds

Sequence Viewer

Length: 519 bp
atggagatactttgttggaattgtcggaggatctgcaatgacaagacaacgagagcattgaaagatttgattgctcaaaaccatcctccaatagttttcctttgtgaaacaaatattagcatccaatctgggtttcgtgatctacatcgtgccctacgatttcctaactcgaatgaggtgttgagtatagggcaatcaggtggacttgcaatgttttggaacaatgattacaacatgcaggttcgcacctcttctgcccatcatattgacctagaaattgggggagggccgggtgatccgcgttggagattaacggggttttacggctactcttgcaccgtagaaagagatcgatcttggcaactactaagggagttgtgcgacttggatacgctaccttgggttattattggggatttcaatgaaatcctcaataacagcgaaaagattaatggtgagtggagagacagatgcgtggctttcaggaagtgttgggctatggggatctactggatttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

172

Amino Acids

20.0

Weight (kDa)

6.41

Isoelectric Point (pI)

42.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031244)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8345901.1_g000001 Rmu_sc0003112.1_g000022

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 229
AccII CGCG 1 cut(s) 301
AciI CCGC 1 cut(s) 299
AclWI GGATC 3 cut(s) 38, 290, 512
AgsI TTSAA 2 cut(s) 61, 421
AjuI GAANNNNNNNTTGG 2 cut(s) 117, 149
Alw26I GTCTC 1 cut(s) 459
AlwI GGATC 3 cut(s) 38, 290, 512
AoxI GGCC 1 cut(s) 287
AseI ATTAAT 1 cut(s) 450
AspS9I GGNCC 1 cut(s) 287
AsuC2I CCSGG 1 cut(s) 291
AsuHPI GGTGA 2 cut(s) 305, 467
BaeGI GKGCMC 1 cut(s) 154
BccI CCATC 2 cut(s) 90, 267
BceAI ACGGC 1 cut(s) 340
BciVI GTATCC 1 cut(s) 382
BcnI CCSGG 1 cut(s) 291
BcoDI GTCTC 1 cut(s) 459
BfaI CTAG 1 cut(s) 272
BfuAI ACCTGC 1 cut(s) 229
BfuI GTATCC 1 cut(s) 382
Bme1390I CCNGG 1 cut(s) 291
BmgT120I GGNCC 1 cut(s) 287
BmrFI CCNGG 1 cut(s) 291
BmsI GCATC 2 cut(s) 129, 461
BpuMI CCSGG 1 cut(s) 291
Bsa29I ATCGAT 1 cut(s) 352
BsaBI GATNNNNATC 1 cut(s) 144
BsaJI CCNNGG 1 cut(s) 398
Bse1I ACTGG 1 cut(s) 515
Bse3DI GCAATG 2 cut(s) 43, 216
Bse8I GATNNNNATC 1 cut(s) 144
BseCI ATCGAT 1 cut(s) 352
BseDI CCNNGG 1 cut(s) 398
BseGI GGATG 2 cut(s) 82, 120
BseJI GATNNNNATC 1 cut(s) 144
BseMI GCAATG 2 cut(s) 43, 216
BseNI ACTGG 1 cut(s) 515
BseSI GKGCMC 1 cut(s) 154
Bsh1236I CGCG 1 cut(s) 301
BshFI GGCC 1 cut(s) 289
BshVI ATCGAT 1 cut(s) 352
BsiSI CCGG 1 cut(s) 290
BsmAI GTCTC 1 cut(s) 459
BsnI GGCC 1 cut(s) 289
Bsp1286I GDGCHC 1 cut(s) 154
Bsp143I GATC 6 cut(s) 30, 139, 295, 349, 353, 504
BspACI CCGC 1 cut(s) 299
BspANI GGCC 1 cut(s) 289
BspDI ATCGAT 1 cut(s) 352
BspFNI CGCG 1 cut(s) 301
BspMI ACCTGC 1 cut(s) 229
BspPI GGATC 3 cut(s) 38, 290, 512
BsrDI GCAATG 2 cut(s) 43, 216
BsrI ACTGG 1 cut(s) 515
BssECI CCNNGG 1 cut(s) 398
BssMI GATC 6 cut(s) 30, 139, 295, 349, 353, 504
BssT1I CCWWGG 1 cut(s) 398
Bst4CI ACNGT 1 cut(s) 340
Bst6I CTCTTC 1 cut(s) 256
BstDEI CTNAG 1 cut(s) 368
BstF5I GGATG 2 cut(s) 82, 120
BstFNI CGCG 1 cut(s) 301
BstKTI GATC 6 cut(s) 33, 142, 298, 352, 356, 507
BstMAI GTCTC 1 cut(s) 459
BstMBI GATC 6 cut(s) 30, 139, 295, 349, 353, 504
BstMWI GCNNNNNNNGC 1 cut(s) 333
BstNSI RCATGY 1 cut(s) 238
BstSCI CCNGG 1 cut(s) 289
BstSLI GKGCMC 1 cut(s) 154
BstUI CGCG 1 cut(s) 301
BstX2I RGATCY 2 cut(s) 30, 504
BstYI RGATCY 2 cut(s) 30, 504
Bsu15I ATCGAT 1 cut(s) 352
BsuI GTATCC 1 cut(s) 382
BsuRI GGCC 1 cut(s) 289
BsuTUI ATCGAT 1 cut(s) 352
BtsCI GGATG 2 cut(s) 82, 120
BveI ACCTGC 1 cut(s) 229
Cfr13I GGNCC 1 cut(s) 287
ClaI ATCGAT 1 cut(s) 352
CviAII CATG 1 cut(s) 235
CviJI RGCY 4 cut(s) 289, 327, 479, 497
CviKI_1 RGCY 4 cut(s) 289, 327, 479, 497
DdeI CTNAG 1 cut(s) 368
DpnI GATC 6 cut(s) 32, 141, 297, 351, 355, 506
DpnII GATC 6 cut(s) 30, 139, 295, 349, 353, 504
Eam1104I CTCTTC 1 cut(s) 256
EarI CTCTTC 1 cut(s) 256
Eco130I CCWWGG 1 cut(s) 398
EcoT14I CCWWGG 1 cut(s) 398
ErhI CCWWGG 1 cut(s) 398
FaeI CATG 1 cut(s) 238
FaiI YATR 4 cut(s) 188, 236, 264, 500
FatI CATG 1 cut(s) 234
FokI GGATG 2 cut(s) 69, 107
FspBI CTAG 1 cut(s) 272
HaeIII GGCC 1 cut(s) 289
HapII CCGG 1 cut(s) 290
Hin1II CATG 1 cut(s) 238
HpaII CCGG 1 cut(s) 290
HphI GGTGA 2 cut(s) 305, 467
Hpy166II GTNNAC 1 cut(s) 203
Hpy188I TCNGA 1 cut(s) 27
Hpy188III TCNNGA 2 cut(s) 137, 484
Hpy8I GTNNAC 1 cut(s) 203
HpyCH4III ACNGT 1 cut(s) 340
HpyCH4V TGCA 4 cut(s) 36, 209, 238, 336
HpyF10VI GCNNNNNNNGC 1 cut(s) 333
HpyF3I CTNAG 1 cut(s) 368
Hsp92II CATG 1 cut(s) 238
Kzo9I GATC 6 cut(s) 30, 139, 295, 349, 353, 504
LpnPI CCDG 6 cut(s) 114, 183, 224, 303, 469, 496
LweI GCATC 2 cut(s) 129, 461
MaeI CTAG 1 cut(s) 272
MalI GATC 6 cut(s) 32, 141, 297, 351, 355, 506
MboI GATC 6 cut(s) 30, 139, 295, 349, 353, 504
MboII GAAGA 1 cut(s) 243
MflI RGATCY 2 cut(s) 30, 504
MhlI GDGCHC 1 cut(s) 154
MluCI AATT 2 cut(s) 19, 276
MmeI TCCRAC 2 cut(s) 5, 284
MnlI CCTC 6 cut(s) 21, 96, 169, 259, 278, 440
MseI TTAA 2 cut(s) 311, 450
MspI CCGG 1 cut(s) 290
MspR9I CCNGG 1 cut(s) 291
MvnI CGCG 1 cut(s) 301
MwoI GCNNNNNNNGC 1 cut(s) 333
NciI CCSGG 1 cut(s) 291
NdeII GATC 6 cut(s) 30, 139, 295, 349, 353, 504
NlaIII CATG 1 cut(s) 238
NspI RCATGY 1 cut(s) 238
PcsI WCGNNNNNNNCGW 1 cut(s) 154
PshBI ATTAAT 1 cut(s) 450
PspPI GGNCC 1 cut(s) 287
PsrI GAACNNNNNNTAC 2 cut(s) 212, 244
PsuI RGATCY 2 cut(s) 30, 504
SaqAI TTAA 2 cut(s) 311, 450
Sau3AI GATC 6 cut(s) 30, 139, 295, 349, 353, 504
Sau96I GGNCC 1 cut(s) 287
ScrFI CCNGG 1 cut(s) 291
SduI GDGCHC 1 cut(s) 154
SetI ASST 6 cut(s) 180, 202, 243, 251, 273, 400
SfaNI GCATC 2 cut(s) 129, 461
Sse9I AATT 2 cut(s) 19, 276
SsiI CCGC 1 cut(s) 299
SspI AATATT 1 cut(s) 115
SspMI CTAG 1 cut(s) 272
StyD4I CCNGG 1 cut(s) 289
StyI CCWWGG 1 cut(s) 398
TaaI ACNGT 1 cut(s) 340
TaqI TCGA 2 cut(s) 170, 352
TasI AATT 2 cut(s) 19, 276
Tru1I TTAA 2 cut(s) 311, 450
Tru9I TTAA 2 cut(s) 311, 450
TspDTI ATGAA 1 cut(s) 438
VspI ATTAAT 1 cut(s) 450
XceI RCATGY 1 cut(s) 238
XspI CTAG 1 cut(s) 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.