Rmu_co8443945.1_g000001

Trafficking protein particle complex subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8443945.1
OG0029963
Physical Location & Seq
Forward (+)
1 .. 1393
1393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8443945.1_g000001.1.cds

Sequence Viewer

Length: 819 bp
agtcgtagcaagccatcaacttctgaagatgagacatcctcttgttccccgcttctgggaagtgatgtgacattgggtactgagggcagctgtggaccacttttcgatatagctagctcgccactggcggatttccaccattgtgaaagactgcagcaggaaatttcacataagggagacgtgaatacagttgacttcatattgatctctcggcctctgaagaatgatactcaccctgtggtttctgatctaccacatcttttttctcatcatgcatgtcactgcagtatcgagagcagaagtcccatatcgtggctggtggatggacctcgaaccttgtatcataacttctcagcttcattttgtgaaataaattttcacatgactatatacaactcatcagatgtcattgcatctgtatgcattaaaacctacgactccaacagtgataatttaagtgatgcaattccagttcaacctgccatgtcttctagcaaccaagatggatggcatgatctcccactagttaatgaaattagagtgacttctgatgtcgttggagctcggactgggaagtcatcgtcagtggagagtgttaccccatttatttggtctgggtcaagctctactaaagtcgaactggagcctaagtcaagaactgagattccccttcaagtttgtgtattctctcccggtacattcgatttgtcaaattatgttttgcattggaaacttttgctttctaatggtgatggtctacagtcttctggggcatgccagggatatccttattatcttaccgtgctccagtctgcctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TRAPPC-Trs85 TRAPPC9-Trs120

Protein Analysis

272

Amino Acids

29.63

Weight (kDa)

5.13

Isoelectric Point (pI)

60.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029963)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0476311
rosa_multiflora Rmu_co8443945.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 574
Acc36I ACCTGC 1 cut(s) 487
AccB7I CCANNNNNTGG 1 cut(s) 312
AccI GTMKAC 1 cut(s) 757
AciI CCGC 2 cut(s) 50, 128
AcsI RAATTY 2 cut(s) 162, 373
AcuI CTGAAG 2 cut(s) 45, 239
AdeI CACNNNGTG 1 cut(s) 238
AfaI GTAC 2 cut(s) 79, 697
AfiI CCNNNNNNNGG 3 cut(s) 55, 56, 312
AgsI TTSAA 2 cut(s) 476, 674
AhlI ACTAGT 1 cut(s) 523
AjiI CACGTC 1 cut(s) 181
AjnI CCWGG 1 cut(s) 777
AleI CACNNNNGTG 1 cut(s) 141
AloI GAACNNNNNNTCC 2 cut(s) 649, 681
AluBI AGCT 6 cut(s) 90, 113, 117, 356, 563, 624
AluI AGCT 6 cut(s) 90, 113, 117, 356, 563, 624
Alw21I GWGCWC 2 cut(s) 565, 807
Alw26I GTCTC 2 cut(s) 26, 171
AoxI GGCC 1 cut(s) 212
ApeKI GCWGC 2 cut(s) 87, 154
ApoI RAATTY 2 cut(s) 162, 373
AspS9I GGNCC 2 cut(s) 95, 326
AsuC2I CCSGG 1 cut(s) 693
AsuHPI GGTGA 2 cut(s) 224, 761
AsuNHI GCTAGC 1 cut(s) 113
AvaII GGWCC 2 cut(s) 95, 326
BaeI ACNNNNGTAYC 2 cut(s) 271, 304
BanII GRGCYC 1 cut(s) 565
BarI GAAGNNNNNNTAC 2 cut(s) 332, 364
BbsI GAAGAC 2 cut(s) 480, 756
Bbv12I GWGCWC 2 cut(s) 565, 807
BbvI GCAGC 2 cut(s) 99, 166
BccI CCATC 5 cut(s) 22, 317, 497, 501, 746
BciT130I CCWGG 1 cut(s) 779
BcnI CCSGG 1 cut(s) 693
BcoDI GTCTC 2 cut(s) 26, 171
BcuI ACTAGT 1 cut(s) 523
BfaI CTAG 3 cut(s) 114, 492, 524
BfmI CTRYAG 3 cut(s) 152, 283, 758
BfuAI ACCTGC 1 cut(s) 487
BisI GCNGC 2 cut(s) 88, 155
BlsI GCNGC 2 cut(s) 89, 156
Bme1390I CCNGG 2 cut(s) 693, 779
Bme18I GGWCC 2 cut(s) 95, 326
BmgBI CACGTC 1 cut(s) 181
BmgT120I GGNCC 2 cut(s) 95, 326
BmiI GGNNCC 1 cut(s) 645
BmrFI CCNGG 2 cut(s) 693, 779
BmrI ACTGGG 1 cut(s) 579
BmsI GCATC 2 cut(s) 422, 451
BmtI GCTAGC 1 cut(s) 117
BmuI ACTGGG 1 cut(s) 579
BpiI GAAGAC 2 cut(s) 480, 756
BplI GAGNNNNNCTC 2 cut(s) 23, 55
BpmI CTGGAG 2 cut(s) 662, 791
BpuMI CCSGG 1 cut(s) 693
BsaJI CCNNGG 1 cut(s) 778
BsaXI ACNNNNNCTCC 2 cut(s) 635, 665
Bsc4I CCNNNNNNNGG 3 cut(s) 55, 56, 312
Bse1I ACTGG 5 cut(s) 129, 470, 574, 645, 808
Bse3DI GCAATG 1 cut(s) 408
BseBI CCWGG 1 cut(s) 779
BseDI CCNNGG 1 cut(s) 778
BseGI GGATG 3 cut(s) 35, 328, 512
BseLI CCNNNNNNNGG 3 cut(s) 55, 56, 312
BseMI GCAATG 1 cut(s) 408
BseMII CTCAG 3 cut(s) 72, 366, 651
BseNI ACTGG 5 cut(s) 129, 470, 574, 645, 808
BseXI GCAGC 2 cut(s) 99, 166
BshFI GGCC 1 cut(s) 214
BsiHKAI GWGCWC 2 cut(s) 565, 807
BsiSI CCGG 1 cut(s) 693
BslFI GGGAC 1 cut(s) 288
BslI CCNNNNNNNGG 3 cut(s) 55, 56, 312
BsmAI GTCTC 2 cut(s) 26, 171
BsmBI CGTCTC 1 cut(s) 171
BsmFI GGGAC 1 cut(s) 288
BsnI GGCC 1 cut(s) 214
Bsp1286I GDGCHC 2 cut(s) 565, 807
Bsp143I GATC 3 cut(s) 204, 247, 514
BspACI CCGC 2 cut(s) 50, 128
BspANI GGCC 1 cut(s) 214
BspCNI CTCAG 3 cut(s) 73, 365, 652
BspLI GGNNCC 1 cut(s) 645
BspMAI CTGCAG 2 cut(s) 156, 287
BspMI ACCTGC 1 cut(s) 487
BspOI GCTAGC 1 cut(s) 117
BsrDI GCAATG 1 cut(s) 408
BsrI ACTGG 5 cut(s) 129, 470, 574, 645, 808
BssECI CCNNGG 1 cut(s) 778
BssMI GATC 3 cut(s) 204, 247, 514
Bst2UI CCWGG 1 cut(s) 779
Bst4CI ACNGT 4 cut(s) 190, 446, 762, 802
BstC8I GCNNGC 4 cut(s) 11, 115, 119, 775
BstDEI CTNAG 4 cut(s) 81, 352, 648, 660
BstF5I GGATG 3 cut(s) 35, 328, 512
BstKTI GATC 3 cut(s) 207, 250, 517
BstMAI GTCTC 2 cut(s) 26, 171
BstMBI GATC 3 cut(s) 204, 247, 514
BstNI CCWGG 1 cut(s) 779
BstNSI RCATGY 2 cut(s) 279, 777
BstSCI CCNGG 2 cut(s) 691, 777
BstSFI CTRYAG 3 cut(s) 152, 283, 758
BstV1I GCAGC 2 cut(s) 99, 166
BstV2I GAAGAC 2 cut(s) 480, 756
BstXI CCANNNNNNTGG 1 cut(s) 609
BsuRI GGCC 1 cut(s) 214
BtrI CACGTC 1 cut(s) 181
BtsCI GGATG 3 cut(s) 35, 328, 512
BtsI GCAGTG 1 cut(s) 280
BtsIMutI CAGTG 4 cut(s) 122, 280, 451, 591
BveI ACCTGC 1 cut(s) 487
Cac8I GCNNGC 4 cut(s) 11, 115, 119, 775
Cfr13I GGNCC 2 cut(s) 95, 326
Csp6I GTAC 2 cut(s) 78, 696
CviAII CATG 6 cut(s) 272, 276, 382, 484, 512, 774
CviQI GTAC 2 cut(s) 78, 696
DdeI CTNAG 4 cut(s) 81, 352, 648, 660
DpnI GATC 3 cut(s) 206, 249, 516
DpnII GATC 3 cut(s) 204, 247, 514
DraIII CACNNNGTG 1 cut(s) 238
DrdI GACNNNNNNGTC 1 cut(s) 574
DseDI GACNNNNNNGTC 1 cut(s) 574
EciI GGCGGA 1 cut(s) 143
Ecl136II GAGCTC 1 cut(s) 563
Eco24I GRGCYC 1 cut(s) 565
Eco32I GATATC 1 cut(s) 785
Eco47I GGWCC 2 cut(s) 95, 326
Eco53kI GAGCTC 1 cut(s) 563
Eco57I CTGAAG 2 cut(s) 45, 239
EcoICRI GAGCTC 1 cut(s) 563
EcoRII CCWGG 1 cut(s) 777
EcoRV GATATC 1 cut(s) 785
EcoT22I ATGCAT 2 cut(s) 277, 425
EcoT38I GRGCYC 1 cut(s) 565
Esp3I CGTCTC 1 cut(s) 171
FaeI CATG 6 cut(s) 275, 279, 385, 487, 515, 777
FaqI GGGAC 1 cut(s) 288
FatI CATG 6 cut(s) 271, 275, 381, 483, 511, 773
FauI CCCGC 1 cut(s) 57
FblI GTMKAC 1 cut(s) 757
Fnu4HI GCNGC 2 cut(s) 88, 155
FokI GGATG 3 cut(s) 22, 335, 519
FriOI GRGCYC 1 cut(s) 565
Fsp4HI GCNGC 2 cut(s) 88, 155
FspBI CTAG 3 cut(s) 114, 492, 524
GluI GCNGC 2 cut(s) 88, 155
GsuI CTGGAG 2 cut(s) 662, 791
HaeIII GGCC 1 cut(s) 214
HapII CCGG 1 cut(s) 693
Hin1II CATG 6 cut(s) 275, 279, 385, 487, 515, 777
HincII GTYRAC 1 cut(s) 193
HindII GTYRAC 1 cut(s) 193
HinfI GANTC 2 cut(s) 437, 664
HpaII CCGG 1 cut(s) 693
HphI GGTGA 2 cut(s) 224, 761
Hpy166II GTNNAC 3 cut(s) 95, 193, 758
Hpy188I TCNGA 6 cut(s) 25, 219, 247, 403, 550, 567
Hpy188III TCNNGA 2 cut(s) 292, 654
Hpy8I GTNNAC 3 cut(s) 95, 193, 758
HpyAV CCTTC 1 cut(s) 680
HpyCH4III ACNGT 4 cut(s) 190, 446, 762, 802
HpyCH4IV ACGT 1 cut(s) 180
HpyCH4V TGCA 7 cut(s) 154, 275, 285, 413, 423, 464, 724
HpyF3I CTNAG 4 cut(s) 81, 352, 648, 660
HpySE526I ACGT 1 cut(s) 180
Hsp92II CATG 6 cut(s) 275, 279, 385, 487, 515, 777
Kzo9I GATC 3 cut(s) 204, 247, 514
LmnI GCTCC 3 cut(s) 560, 643, 810
Lsp1109I GCAGC 2 cut(s) 99, 166
LweI GCATC 2 cut(s) 422, 451
MaeI CTAG 3 cut(s) 114, 492, 524
MaeII ACGT 1 cut(s) 180
MaeIII GTNAC 4 cut(s) 67, 278, 541, 595
MalI GATC 3 cut(s) 206, 249, 516
MboI GATC 3 cut(s) 204, 247, 514
MboII GAAGA 4 cut(s) 38, 232, 480, 756
MhlI GDGCHC 2 cut(s) 565, 807
MluCI AATT 6 cut(s) 162, 373, 451, 465, 534, 712
MlyI GAGTC 1 cut(s) 431
MmeI TCCRAC 2 cut(s) 465, 538
MnlI CCTC 4 cut(s) 49, 76, 225, 339
Mph1103I ATGCAT 2 cut(s) 277, 425
MseI TTAA 3 cut(s) 426, 455, 528
MslI CAYNNNNRTG 2 cut(s) 141, 418
MspA1I CMGCKG 1 cut(s) 90
MspI CCGG 1 cut(s) 693
MspR9I CCNGG 2 cut(s) 693, 779
MvaI CCWGG 1 cut(s) 779
NciI CCSGG 1 cut(s) 693
NdeII GATC 3 cut(s) 204, 247, 514
NheI GCTAGC 1 cut(s) 113
NlaIII CATG 6 cut(s) 275, 279, 385, 487, 515, 777
NlaIV GGNNCC 1 cut(s) 645
NmeAIII GCCGAG 1 cut(s) 190
NmuCI GTSAC 3 cut(s) 67, 278, 541
NsiI ATGCAT 2 cut(s) 277, 425
NspI RCATGY 2 cut(s) 279, 777
OliI CACNNNNGTG 1 cut(s) 141
PaeI GCATGC 1 cut(s) 777
PfeI GAWTC 1 cut(s) 664
PflMI CCANNNNNTGG 1 cut(s) 312
PkrI GCNGC 2 cut(s) 89, 156
PleI GAGTC 1 cut(s) 431
PpsI GAGTC 1 cut(s) 431
Psp124BI GAGCTC 1 cut(s) 565
Psp6I CCWGG 1 cut(s) 777
PspGI CCWGG 1 cut(s) 777
PspN4I GGNNCC 1 cut(s) 645
PspPI GGNCC 2 cut(s) 95, 326
PstI CTGCAG 2 cut(s) 156, 287
PvuII CAGCTG 1 cut(s) 90
RsaI GTAC 2 cut(s) 79, 697
RsaNI GTAC 2 cut(s) 78, 696
RseI CAYNNNNRTG 2 cut(s) 141, 418
SacI GAGCTC 1 cut(s) 565
SaqAI TTAA 3 cut(s) 426, 455, 528
SatI GCNGC 2 cut(s) 88, 155
Sau3AI GATC 3 cut(s) 204, 247, 514
Sau96I GGNCC 2 cut(s) 95, 326
SchI GAGTC 1 cut(s) 431
ScrFI CCNGG 2 cut(s) 693, 779
SduI GDGCHC 2 cut(s) 565, 807
SfaNI GCATC 2 cut(s) 422, 451
SfcI CTRYAG 3 cut(s) 152, 283, 758
SinI GGWCC 2 cut(s) 95, 326
SmiMI CAYNNNNRTG 2 cut(s) 141, 418
SpeI ACTAGT 1 cut(s) 523
SphI GCATGC 1 cut(s) 777
Sse9I AATT 6 cut(s) 162, 373, 451, 465, 534, 712
SsiI CCGC 2 cut(s) 50, 128
SspMI CTAG 3 cut(s) 114, 492, 524
SstI GAGCTC 1 cut(s) 565
StyD4I CCNGG 2 cut(s) 691, 777
TaaI ACNGT 4 cut(s) 190, 446, 762, 802
TaiI ACGT 1 cut(s) 183
TaqI TCGA 5 cut(s) 105, 291, 331, 636, 702
TasI AATT 6 cut(s) 162, 373, 451, 465, 534, 712
TfiI GAWTC 1 cut(s) 664
Tru1I TTAA 3 cut(s) 426, 455, 528
Tru9I TTAA 3 cut(s) 426, 455, 528
TscAI CASTG 4 cut(s) 129, 287, 451, 591
TseFI GTSAC 3 cut(s) 67, 278, 541
TseI GCWGC 2 cut(s) 87, 154
Tsp45I GTSAC 3 cut(s) 67, 278, 541
TspDTI ATGAA 3 cut(s) 187, 348, 546
TspRI CASTG 4 cut(s) 129, 287, 451, 591
Van91I CCANNNNNTGG 1 cut(s) 312
VpaK11BI GGWCC 2 cut(s) 95, 326
XapI RAATTY 2 cut(s) 162, 373
XceI RCATGY 2 cut(s) 279, 777
XcmI CCANNNNNNNNNTGG 1 cut(s) 313
XmiI GTMKAC 1 cut(s) 757
XspI CTAG 3 cut(s) 114, 492, 524
Zsp2I ATGCAT 2 cut(s) 277, 425
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.