Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8448945.1

Orthogroup ID

OG0012019

Physical Location & Seq

Genomic Coordinates Forward (+)

392 .. 1133

Gene Structure 742 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8448945.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 411 bp

atgggtgtcaactcaaacagagttgaggaccttccatgccaccatgatcatcatcaaaccaccactgtgagaatcccatcagatatagatttagaggcaatgccaccccctgaaattcacagggtttgtttgccaccaaaacagagcaccttgcagaaactcaagcataggcttggtgagatctttttccctgaaaacccacttcatagattcaagaaccaaacttggttcacaaaactgcttctggctcttcaattcttgttcccaatcttccaatggggtcctgaatacaatgctcagcttttgaagtctgatatcatctctggcctcactattgctagccttgcaattcctcagggtatcagttatgcaaagcttgcaagtttgccaccaatagttgggctatgttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005575 GO:0005623 GO:0005886 GO:0005887 GO:0005911 GO:0006810 GO:0006811 GO:0006820 GO:0008150 GO:0008272 GO:0008509 GO:0009506 GO:0015075 GO:0015103 GO:0015116 GO:0015318 GO:0015698 GO:0016020 GO:0016021 GO:0022857 GO:0030054 GO:0031224 GO:0031226 GO:0034220 GO:0044425 GO:0044459 GO:0044464 GO:0051179 GO:0051234 GO:0055044 GO:0055085 GO:0071944 GO:0072348 GO:0098656 GO:0098660 GO:0098661 GO:1901682 GO:1902358

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

STAS Sulfate_transp

Protein Analysis

136

Amino Acids

15.4

Weight (kDa)

7.81

Isoelectric Point (pI)

42.22

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012019)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G15990
fragaria_vesca	FvH4_6g31040
malus_domestica	MD17G1196100.v1.1
prunus_persica	Prupe.3G072000_v2.0.a1 Prupe.3G072000_v2.0.a1
pyrus_communis	pycom17g20150
rosa_chinensis	RchiOBHm_Chr2g0137741
rosa_laevigata	RLG00000019672
rosa_multiflora	Rmu_co8448945.1_g000001 Rmu_sc0017792.1_g000002
rosa_roxburghii	Rroxscaffold_2G00106880
rosa_rugosa	Rorug02G0344500 Rorug02G0344600 Rorug02G0344600
rosa_samantha	Rh2AG392400 Rh2BG399900 Rh2CG379000 Rh2DG414700
rosa_wichuraiana	Rw2G032140

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	398
AcsI	RAATTY	1 cut(s)	114
AfiI	CCNNNNNNNGG	1 cut(s)	398
AgsI	TTSAA	3 cut(s)	214, 254, 307
AleI	CACNNNNGTG	1 cut(s)	65
AluBI	AGCT	2 cut(s)	301, 376
AluI	AGCT	2 cut(s)	301, 376
Alw21I	GWGCWC	1 cut(s)	149
AoxI	GGCC	1 cut(s)	325
ApoI	RAATTY	1 cut(s)	114
AspS9I	GGNCC	2 cut(s)	28, 281
AsuHPI	GGTGA	1 cut(s)	188
AsuNHI	GCTAGC	1 cut(s)	338
AvaII	GGWCC	2 cut(s)	28, 281
AxyI	CCTNAGG	1 cut(s)	354
Bbv12I	GWGCWC	1 cut(s)	149
BccI	CCATC	1 cut(s)	85
BclI	TGATCA	1 cut(s)	46
BfaI	CTAG	1 cut(s)	339
BglII	AGATCT	1 cut(s)	180
BlpI	GCTNAGC	1 cut(s)	297
Bme18I	GGWCC	2 cut(s)	28, 281
BmgT120I	GGNCC	2 cut(s)	28, 281
BmiI	GGNNCC	1 cut(s)	282
BmtI	GCTAGC	1 cut(s)	342
Bpu1102I	GCTNAGC	1 cut(s)	297
BpuEI	CTTGAG	1 cut(s)	146
BsaBI	GATNNNNATC	1 cut(s)	51
Bsc4I	CCNNNNNNNGG	1 cut(s)	398
Bse21I	CCTNAGG	1 cut(s)	354
Bse3DI	GCAATG	1 cut(s)	105
Bse8I	GATNNNNATC	1 cut(s)	51
BseJI	GATNNNNATC	1 cut(s)	51
BseLI	CCNNNNNNNGG	1 cut(s)	398
BseMI	GCAATG	1 cut(s)	105
BseMII	CTCAG	2 cut(s)	311, 368
BshFI	GGCC	1 cut(s)	327
BsiHKAI	GWGCWC	1 cut(s)	149
BslI	CCNNNNNNNGG	1 cut(s)	398
BsnI	GGCC	1 cut(s)	327
Bsp1286I	GDGCHC	1 cut(s)	149
Bsp143I	GATC	2 cut(s)	46, 180
Bsp1720I	GCTNAGC	1 cut(s)	297
BspANI	GGCC	1 cut(s)	327
BspCNI	CTCAG	2 cut(s)	310, 367
BspLI	GGNNCC	1 cut(s)	282
BspOI	GCTAGC	1 cut(s)	342
BspQI	GCTCTTC	1 cut(s)	255
BsrDI	GCAATG	1 cut(s)	105
BssMI	GATC	2 cut(s)	46, 180
Bst4CI	ACNGT	1 cut(s)	67
Bst6I	CTCTTC	1 cut(s)	255
BstAPI	GCANNNNNTGC	1 cut(s)	377
BstC8I	GCNNGC	2 cut(s)	340, 378
BstDEI	CTNAG	2 cut(s)	297, 354
BstKTI	GATC	2 cut(s)	49, 183
BstMBI	GATC	2 cut(s)	46, 180
BstMWI	GCNNNNNNNGC	2 cut(s)	344, 377
BstX2I	RGATCY	1 cut(s)	180
BstYI	RGATCY	1 cut(s)	180
Bsu36I	CCTNAGG	1 cut(s)	354
BsuRI	GGCC	1 cut(s)	327
BtsIMutI	CAGTG	1 cut(s)	63
Cac8I	GCNNGC	2 cut(s)	340, 378
Cfr13I	GGNCC	2 cut(s)	28, 281
CviAII	CATG	2 cut(s)	36, 44
CviJI	RGCY	7 cut(s)	172, 248, 301, 327, 342, 376, 403
CviKI_1	RGCY	7 cut(s)	172, 248, 301, 327, 342, 376, 403
DdeI	CTNAG	2 cut(s)	297, 354
DpnI	GATC	2 cut(s)	48, 182
DpnII	GATC	2 cut(s)	46, 180
Eam1104I	CTCTTC	1 cut(s)	255
EarI	CTCTTC	1 cut(s)	255
Eco32I	GATATC	1 cut(s)	316
Eco47I	GGWCC	2 cut(s)	28, 281
Eco81I	CCTNAGG	1 cut(s)	354
EcoO109I	RGGNCCY	2 cut(s)	28, 281
EcoRV	GATATC	1 cut(s)	316
FaeI	CATG	2 cut(s)	39, 47
FaiI	YATR	7 cut(s)	37, 45, 86, 168, 207, 369, 406
FatI	CATG	2 cut(s)	35, 43
FbaI	TGATCA	1 cut(s)	46
FspBI	CTAG	1 cut(s)	339
HaeIII	GGCC	1 cut(s)	327
Hin1II	CATG	2 cut(s)	39, 47
HincII	GTYRAC	1 cut(s)	10
HindII	GTYRAC	1 cut(s)	10
HindIII	AAGCTT	1 cut(s)	374
HinfI	GANTC	2 cut(s)	72, 210
HphI	GGTGA	1 cut(s)	188
Hpy166II	GTNNAC	2 cut(s)	10, 231
Hpy188I	TCNGA	2 cut(s)	82, 313
Hpy188III	TCNNGA	2 cut(s)	214, 284
Hpy8I	GTNNAC	2 cut(s)	10, 231
HpyAV	CCTTC	1 cut(s)	41
HpyCH4III	ACNGT	1 cut(s)	67
HpyCH4V	TGCA	4 cut(s)	154, 347, 371, 380
HpyF10VI	GCNNNNNNNGC	2 cut(s)	344, 377
HpyF3I	CTNAG	2 cut(s)	297, 354
Hsp92II	CATG	2 cut(s)	39, 47
Ksp22I	TGATCA	1 cut(s)	46
Kzo9I	GATC	2 cut(s)	46, 180
LguI	GCTCTTC	1 cut(s)	255
LpnPI	CCDG	7 cut(s)	106, 123, 204, 230, 297, 309, 341
MaeI	CTAG	1 cut(s)	339
MalI	GATC	2 cut(s)	48, 182
MboI	GATC	2 cut(s)	46, 180
MboII	GAAGA	2 cut(s)	242, 262
MflI	RGATCY	1 cut(s)	180
MhlI	GDGCHC	1 cut(s)	149
MluCI	AATT	3 cut(s)	114, 254, 348
MnlI	CCTC	4 cut(s)	19, 88, 338, 363
MslI	CAYNNNNRTG	1 cut(s)	65
MwoI	GCNNNNNNNGC	2 cut(s)	344, 377
NdeII	GATC	2 cut(s)	46, 180
NheI	GCTAGC	1 cut(s)	338
NlaIII	CATG	2 cut(s)	39, 47
NlaIV	GGNNCC	1 cut(s)	282
OliI	CACNNNNGTG	1 cut(s)	65
PciSI	GCTCTTC	1 cut(s)	255
PfeI	GAWTC	2 cut(s)	72, 210
PflMI	CCANNNNNTGG	1 cut(s)	398
PpuMI	RGGWCCY	2 cut(s)	28, 281
Psp5II	RGGWCCY	2 cut(s)	28, 281
PspN4I	GGNNCC	1 cut(s)	282
PspPI	GGNCC	2 cut(s)	28, 281
PspPPI	RGGWCCY	2 cut(s)	28, 281
PsuI	RGATCY	1 cut(s)	180
RseI	CAYNNNNRTG	1 cut(s)	65
SapI	GCTCTTC	1 cut(s)	255
Sau3AI	GATC	2 cut(s)	46, 180
Sau96I	GGNCC	2 cut(s)	28, 281
SduI	GDGCHC	1 cut(s)	149
SetI	ASST	4 cut(s)	33, 152, 303, 378
SinI	GGWCC	2 cut(s)	28, 281
SmiMI	CAYNNNNRTG	1 cut(s)	65
SmlI	CTYRAG	1 cut(s)	161
SmoI	CTYRAG	1 cut(s)	161
Sse9I	AATT	3 cut(s)	114, 254, 348
SspMI	CTAG	1 cut(s)	339
TaaI	ACNGT	1 cut(s)	67
TasI	AATT	3 cut(s)	114, 254, 348
TfiI	GAWTC	2 cut(s)	72, 210
TscAI	CASTG	1 cut(s)	70
TspDTI	ATGAA	1 cut(s)	194
TspRI	CASTG	1 cut(s)	70
Van91I	CCANNNNNTGG	1 cut(s)	398
VpaK11BI	GGWCC	2 cut(s)	28, 281
XapI	RAATTY	1 cut(s)	114
XcmI	CCANNNNNNNNNTGG	1 cut(s)	273
XspI	CTAG	1 cut(s)	339

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.