Rmu_sc0000302.1_g000008

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000302.1
OG0031062
Physical Location & Seq
Forward (+)
12795 .. 13145
351 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 351 bp
atgagtaacctgaacaaattggactttgctccattgggaacaactggctctgaatatcacaggtgggttcgtgatgtccgccagcatctcaaggccgatggaatcgtggatacgattctaaagcctgggcaagacgtgctaattgttgggcaagctcaagctttggaagcaaatagagcatccttagaggaaaataaggcgaaagccatcagcctaataactcgtcatatagatgatttgacccagtacgagtgtatgaatgaaaaagaccccagaagcctgtgggtcccactcgaagaaagatttggcaacgtccgtgactccttgcttcctgacctagaagcgagatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

116

Amino Acids

13.17

Weight (kDa)

5.33

Isoelectric Point (pI)

43.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031062)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000302.1_g000008 Rmu_sc0017136.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AfaI GTAC 1 cut(s) 248
AjiI CACGTC 1 cut(s) 136
AjnI CCWGG 1 cut(s) 124
AjuI GAANNNNNNNTTGG 2 cut(s) 288, 320
AluBI AGCT 2 cut(s) 155, 161
AluI AGCT 2 cut(s) 155, 161
AoxI GGCC 1 cut(s) 93
AspS9I GGNCC 1 cut(s) 286
AvaII GGWCC 1 cut(s) 286
BccI CCATC 2 cut(s) 92, 215
BciT130I CCWGG 1 cut(s) 126
BciVI GTATCC 1 cut(s) 103
BfaI CTAG 1 cut(s) 338
BfuI GTATCC 1 cut(s) 103
Bme1390I CCNGG 1 cut(s) 126
Bme18I GGWCC 1 cut(s) 286
BmgBI CACGTC 1 cut(s) 136
BmgT120I GGNCC 1 cut(s) 286
BmiI GGNNCC 2 cut(s) 287, 288
BmrFI CCNGG 1 cut(s) 126
BmrI ACTGGG 1 cut(s) 238
BmsI GCATC 2 cut(s) 94, 188
BmuI ACTGGG 1 cut(s) 238
BpuEI CTTGAG 2 cut(s) 74, 141
BsaJI CCNNGG 1 cut(s) 125
Bse1I ACTGG 2 cut(s) 49, 244
BseBI CCWGG 1 cut(s) 126
BseDI CCNNGG 1 cut(s) 125
BseGI GGATG 1 cut(s) 179
BseNI ACTGG 2 cut(s) 49, 244
BshFI GGCC 1 cut(s) 95
BslFI GGGAC 1 cut(s) 272
BsmFI GGGAC 1 cut(s) 272
BsnI GGCC 1 cut(s) 95
BspACI CCGC 1 cut(s) 79
BspANI GGCC 1 cut(s) 95
BspLI GGNNCC 2 cut(s) 287, 288
BsrI ACTGG 2 cut(s) 49, 244
BssECI CCNNGG 1 cut(s) 125
Bst2UI CCWGG 1 cut(s) 126
BstAPI GCANNNNNTGC 1 cut(s) 136
BstC8I GCNNGC 2 cut(s) 83, 153
BstDEI CTNAG 1 cut(s) 184
BstF5I GGATG 1 cut(s) 179
BstMWI GCNNNNNNNGC 3 cut(s) 136, 167, 176
BstNI CCWGG 1 cut(s) 126
BstSCI CCNGG 1 cut(s) 124
BsuI GTATCC 1 cut(s) 103
BsuRI GGCC 1 cut(s) 95
BtrI CACGTC 1 cut(s) 136
BtsCI GGATG 1 cut(s) 179
Cac8I GCNNGC 2 cut(s) 83, 153
Cfr13I GGNCC 1 cut(s) 286
Csp6I GTAC 1 cut(s) 247
CviJI RGCY 8 cut(s) 48, 95, 124, 155, 161, 206, 213, 279
CviKI_1 RGCY 8 cut(s) 48, 95, 124, 155, 161, 206, 213, 279
CviQI GTAC 1 cut(s) 247
DdeI CTNAG 1 cut(s) 184
EciI GGCGGA 1 cut(s) 68
Eco47I GGWCC 1 cut(s) 286
EcoO109I RGGNCCY 1 cut(s) 286
EcoRII CCWGG 1 cut(s) 124
FaiI YATR 3 cut(s) 228, 230, 257
FaqI GGGAC 1 cut(s) 272
FokI GGATG 1 cut(s) 166
FspBI CTAG 1 cut(s) 338
HaeIII GGCC 1 cut(s) 95
HindIII AAGCTT 1 cut(s) 159
HinfI GANTC 3 cut(s) 102, 115, 320
Hpy188I TCNGA 1 cut(s) 52
Hpy188III TCNNGA 2 cut(s) 71, 332
HpyCH4IV ACGT 2 cut(s) 135, 312
HpyF10VI GCNNNNNNNGC 3 cut(s) 136, 167, 176
HpyF3I CTNAG 1 cut(s) 184
HpySE526I ACGT 2 cut(s) 135, 312
KflI GGGWCCC 1 cut(s) 286
LmnI GCTCC 1 cut(s) 34
LweI GCATC 2 cut(s) 94, 188
MaeI CTAG 1 cut(s) 338
MaeII ACGT 2 cut(s) 135, 312
MaeIII GTNAC 2 cut(s) 5, 317
MboII GAAGA 1 cut(s) 308
MluCI AATT 2 cut(s) 17, 141
MlyI GAGTC 1 cut(s) 314
MnlI CCTC 1 cut(s) 181
MslI CAYNNNNRTG 1 cut(s) 231
MspR9I CCNGG 1 cut(s) 126
MvaI CCWGG 1 cut(s) 126
MwoI GCNNNNNNNGC 3 cut(s) 136, 167, 176
NlaIV GGNNCC 2 cut(s) 287, 288
NmuCI GTSAC 1 cut(s) 317
PfeI GAWTC 2 cut(s) 102, 115
PleI GAGTC 1 cut(s) 314
PpsI GAGTC 1 cut(s) 314
PpuMI RGGWCCY 1 cut(s) 286
Psp5II RGGWCCY 1 cut(s) 286
Psp6I CCWGG 1 cut(s) 124
PspGI CCWGG 1 cut(s) 124
PspN4I GGNNCC 2 cut(s) 287, 288
PspPI GGNCC 1 cut(s) 286
PspPPI RGGWCCY 1 cut(s) 286
RsaI GTAC 1 cut(s) 248
RsaNI GTAC 1 cut(s) 247
RseI CAYNNNNRTG 1 cut(s) 231
Sau96I GGNCC 1 cut(s) 286
SchI GAGTC 1 cut(s) 314
ScrFI CCNGG 1 cut(s) 126
SetI ASST 7 cut(s) 12, 65, 138, 157, 163, 315, 339
SfaNI GCATC 2 cut(s) 94, 188
SinI GGWCC 1 cut(s) 286
SmiMI CAYNNNNRTG 1 cut(s) 231
SmlI CTYRAG 2 cut(s) 89, 156
SmoI CTYRAG 2 cut(s) 89, 156
Sse9I AATT 2 cut(s) 17, 141
SsiI CCGC 1 cut(s) 79
SspMI CTAG 1 cut(s) 338
StyD4I CCNGG 1 cut(s) 124
TaiI ACGT 2 cut(s) 138, 315
TaqI TCGA 1 cut(s) 294
TasI AATT 2 cut(s) 17, 141
TfiI GAWTC 2 cut(s) 102, 115
TseFI GTSAC 1 cut(s) 317
Tsp45I GTSAC 1 cut(s) 317
TspDTI ATGAA 2 cut(s) 272, 276
TspGWI ACGGA 1 cut(s) 305
VpaK11BI GGWCC 1 cut(s) 286
XspI CTAG 1 cut(s) 338
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.