Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000440.1

Orthogroup ID

OG0023044

Physical Location & Seq

Genomic Coordinates Reverse (-)

14575 .. 14937

Gene Structure 363 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 270 bp

atggagatatctgagccgttgctggtggccgattcagacaaaatcaaggccgttgaggacgaccaagtgtcggaatggaagaagcaggtcatggtcagagggctggtggtcagcgtcgagcttgggtccgtcttctgcatcatcacccacaagatgaatctgacgatgggatcatcccaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagggggagagatgagagacagagagggagagtgtccaatctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005774 GO:0006810 GO:0008150 GO:0016020 GO:0022857 GO:0031090 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0051179 GO:0051234 GO:0055085 GO:0098588 GO:0098805

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

OPT

Protein Analysis

89

Amino Acids

10.15

Weight (kDa)

4.05

Isoelectric Point (pI)

90.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023044)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0000440.1_g000004
rosa_samantha	Rh3DG372100 Rh4CG349000 Rh4DG330400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	76
AclWI	GGATC	1 cut(s)	178
AcoI	YGGCCR	1 cut(s)	27
AfiI	CCNNNNNNNGG	1 cut(s)	70
AhdI	GACNNNNNGTC	1 cut(s)	67
AluBI	AGCT	1 cut(s)	121
AluI	AGCT	1 cut(s)	121
Alw26I	GTCTC	1 cut(s)	237
AlwI	GGATC	1 cut(s)	178
AoxI	GGCC	2 cut(s)	27, 48
AspS9I	GGNCC	1 cut(s)	126
AsuHPI	GGTGA	1 cut(s)	136
AvaII	GGWCC	1 cut(s)	126
BbsI	GAAGAC	1 cut(s)	124
BccI	CCATC	1 cut(s)	160
BceAI	ACGGC	1 cut(s)	35
BcoDI	GTCTC	1 cut(s)	237
BfaI	CTAG	1 cut(s)	268
BfuAI	ACCTGC	1 cut(s)	76
Bme18I	GGWCC	1 cut(s)	126
BmeRI	GACNNNNNGTC	1 cut(s)	67
BmgT120I	GGNCC	1 cut(s)	126
BmiI	GGNNCC	1 cut(s)	127
BmsI	GCATC	1 cut(s)	147
BpiI	GAAGAC	1 cut(s)	124
Bsc4I	CCNNNNNNNGG	1 cut(s)	70
BseGI	GGATG	1 cut(s)	173
BseLI	CCNNNNNNNGG	1 cut(s)	70
BshFI	GGCC	2 cut(s)	29, 50
BslI	CCNNNNNNNGG	1 cut(s)	70
BsmAI	GTCTC	1 cut(s)	237
BsnI	GGCC	2 cut(s)	29, 50
Bsp143I	GATC	1 cut(s)	170
BspANI	GGCC	2 cut(s)	29, 50
BspCNI	CTCAG	1 cut(s)	4
BspLI	GGNNCC	1 cut(s)	127
BspMI	ACCTGC	1 cut(s)	76
BspPI	GGATC	1 cut(s)	178
BssMI	GATC	1 cut(s)	170
BstDEI	CTNAG	1 cut(s)	12
BstF5I	GGATG	1 cut(s)	173
BstKTI	GATC	1 cut(s)	173
BstMAI	GTCTC	1 cut(s)	237
BstMBI	GATC	1 cut(s)	170
BstV2I	GAAGAC	1 cut(s)	124
BsuRI	GGCC	2 cut(s)	29, 50
BtsCI	GGATG	1 cut(s)	173
BveI	ACCTGC	1 cut(s)	76
Cfr13I	GGNCC	1 cut(s)	126
CseI	GACGC	1 cut(s)	103
CviAII	CATG	1 cut(s)	91
CviJI	RGCY	5 cut(s)	16, 29, 50, 103, 121
CviKI_1	RGCY	5 cut(s)	16, 29, 50, 103, 121
DdeI	CTNAG	1 cut(s)	12
DpnI	GATC	1 cut(s)	172
DpnII	GATC	1 cut(s)	170
DriI	GACNNNNNGTC	1 cut(s)	67
EaeI	YGGCCR	1 cut(s)	27
Eam1105I	GACNNNNNGTC	1 cut(s)	67
Eco32I	GATATC	1 cut(s)	9
Eco47I	GGWCC	1 cut(s)	126
EcoRV	GATATC	1 cut(s)	9
FaeI	CATG	1 cut(s)	94
FaiI	YATR	1 cut(s)	92
FatI	CATG	1 cut(s)	90
FokI	GGATG	1 cut(s)	160
FspBI	CTAG	1 cut(s)	268
HaeIII	GGCC	2 cut(s)	29, 50
HgaI	GACGC	1 cut(s)	103
Hin1II	CATG	1 cut(s)	94
HinfI	GANTC	2 cut(s)	32, 157
HphI	GGTGA	1 cut(s)	136
Hpy188I	TCNGA	5 cut(s)	13, 37, 73, 98, 162
Hpy99I	CGWCG	1 cut(s)	119
HpyAV	CCTTC	1 cut(s)	221
HpyCH4V	TGCA	1 cut(s)	138
HpyF3I	CTNAG	1 cut(s)	12
Hsp92II	CATG	1 cut(s)	94
Kzo9I	GATC	1 cut(s)	170
LpnPI	CCDG	3 cut(s)	8, 71, 89
LweI	GCATC	1 cut(s)	147
MaeI	CTAG	1 cut(s)	268
MalI	GATC	1 cut(s)	172
MboI	GATC	1 cut(s)	170
MmeI	TCCRAC	1 cut(s)	51
MnlI	CCTC	3 cut(s)	49, 92, 244
NdeII	GATC	1 cut(s)	170
NlaIII	CATG	1 cut(s)	94
NlaIV	GGNNCC	1 cut(s)	127
PfeI	GAWTC	2 cut(s)	32, 157
PspN4I	GGNNCC	1 cut(s)	127
PspPI	GGNCC	1 cut(s)	126
Sau3AI	GATC	1 cut(s)	170
Sau96I	GGNCC	1 cut(s)	126
SetI	ASST	2 cut(s)	90, 123
SfaNI	GCATC	1 cut(s)	147
SinI	GGWCC	1 cut(s)	126
SspMI	CTAG	1 cut(s)	268
TaqI	TCGA	1 cut(s)	117
TfiI	GAWTC	2 cut(s)	32, 157
TspDTI	ATGAA	1 cut(s)	170
TspGWI	ACGGA	1 cut(s)	118
VpaK11BI	GGWCC	1 cut(s)	126
XspI	CTAG	1 cut(s)	268

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.