Rmu_sc0000516.1_g000063

DNA excision repair protein ERCC-6-like 2

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000516.1
OG0023046
Physical Location & Seq
Reverse (-)
268347 .. 270189
1843 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000516.1_g000063.1.cds

Sequence Viewer

Length: 744 bp
atggtgatcgcattgattccaattctgaagagaaataaaatagcagaacgaaaccctgttctcatagttttccctagttcagttatccacaactgggagagtgaattctctaagtggtctaactttagtgttgctgtttaccatggtgcaaatcgtgatttgatttatgataaattggaagctcatggagttgagatacttatcacaagctttaacacatacagaatttgtggcagccagttttcatatgttaattgggggattgttgttgtcgatgaggcacaccggtttaagaatgaaaaatcaaagctctacatagcatgtctagaatttaaaacctcaaaacgaattgctttcactggaactatgatgaagaacaaaatcatggaattgtttaacctgtttgactgggttgcacctggatcgttaggaacatgggaacattttcgggagttttatgatgaacctctcaaacatggccaaagatcaactgctccggaaggatttgtccgcattgctgatgagcgaaaacagcatctagtagctgttaatgttgagaaggacaaaagaggaaaccattggagcgtgaggatctcagccgcggcctcggattttccttctgaaatggctgatgcagcctccatcagcaactgctttgaacacctcatagtcgccggagatgccaccgaggaggatgaagacgacgatgaagtaggcgaaggcgaaaccggcttctgggtctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0016020
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Helicase_C SNF2_N

Protein Analysis

247

Amino Acids

28.17

Weight (kDa)

5.4

Isoelectric Point (pI)

26.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023046)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000516.1_g000023 Rmu_sc0000516.1_g000063 Rmu_sc0000516.1_g000066 Rmu_sc0018229.1_g000004

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 602
AccIII TCCGGA 1 cut(s) 496
AciI CCGC 3 cut(s) 511, 600, 602
AclWI GGATC 2 cut(s) 430, 599
AcoI YGGCCR 1 cut(s) 478
AcsI RAATTY 3 cut(s) 104, 225, 329
AcuI CTGAAG 1 cut(s) 47
AfiI CCNNNNNNNGG 2 cut(s) 94, 735
AgeI ACCGGT 1 cut(s) 285
AgsI TTSAA 1 cut(s) 659
AjnI CCWGG 1 cut(s) 418
AluBI AGCT 4 cut(s) 182, 210, 310, 545
AluI AGCT 4 cut(s) 182, 210, 310, 545
AlwI GGATC 2 cut(s) 430, 599
AlwNI CAGNNNCTG 1 cut(s) 651
Aor13HI TCCGGA 1 cut(s) 496
AoxI GGCC 2 cut(s) 478, 603
ApeKI GCWGC 2 cut(s) 234, 635
ApoI RAATTY 3 cut(s) 104, 225, 329
AsiGI ACCGGT 1 cut(s) 285
Asp700I GAANNNNTTC 1 cut(s) 444
AsuHPI GGTGA 1 cut(s) 16
BalI TGGCCA 1 cut(s) 480
BbsI GAAGAC 1 cut(s) 705
BbvI GCAGC 2 cut(s) 246, 647
BccI CCATC 1 cut(s) 650
BcgI CGANNNNNNTGC 2 cut(s) 405, 439
BciT130I CCWGG 1 cut(s) 420
BfaI CTAG 3 cut(s) 75, 326, 539
BisI GCNGC 4 cut(s) 235, 600, 603, 636
BlsI GCNGC 4 cut(s) 236, 601, 604, 637
Bme1390I CCNGG 1 cut(s) 420
BmrFI CCNGG 1 cut(s) 420
BmrI ACTGGG 2 cut(s) 103, 418
BmsI GCATC 3 cut(s) 544, 622, 670
BmuI ACTGGG 2 cut(s) 103, 418
BpiI GAAGAC 1 cut(s) 705
BsaBI GATNNNNATC 1 cut(s) 200
BsaJI CCNNGG 4 cut(s) 142, 600, 606, 687
BsaWI WCCGGW 2 cut(s) 285, 496
Bsc4I CCNNNNNNNGG 2 cut(s) 94, 735
Bse118I RCCGGY 2 cut(s) 285, 728
Bse1I ACTGG 4 cut(s) 98, 238, 364, 413
Bse3DI GCAATG 1 cut(s) 513
Bse8I GATNNNNATC 1 cut(s) 200
BseAI TCCGGA 1 cut(s) 496
BseBI CCWGG 1 cut(s) 420
BseDI CCNNGG 4 cut(s) 142, 600, 606, 687
BseGI GGATG 1 cut(s) 700
BseJI GATNNNNATC 1 cut(s) 200
BseLI CCNNNNNNNGG 2 cut(s) 94, 735
BseMI GCAATG 1 cut(s) 513
BseMII CTCAG 1 cut(s) 609
BseNI ACTGG 4 cut(s) 98, 238, 364, 413
BseRI GAGGAG 1 cut(s) 704
BseXI GCAGC 2 cut(s) 246, 647
Bsh1236I CGCG 1 cut(s) 602
BshFI GGCC 2 cut(s) 480, 605
BshTI ACCGGT 1 cut(s) 285
BsiSI CCGG 4 cut(s) 286, 497, 675, 729
BslI CCNNNNNNNGG 2 cut(s) 94, 735
BsnI GGCC 2 cut(s) 480, 605
Bsp13I TCCGGA 1 cut(s) 496
Bsp143I GATC 4 cut(s) 6, 422, 485, 591
Bsp19I CCATGG 1 cut(s) 142
BspACI CCGC 3 cut(s) 511, 600, 602
BspANI GGCC 2 cut(s) 480, 605
BspCNI CTCAG 1 cut(s) 608
BspEI TCCGGA 1 cut(s) 496
BspFNI CGCG 1 cut(s) 602
BspPI GGATC 2 cut(s) 430, 599
BsrDI GCAATG 1 cut(s) 513
BsrFI RCCGGY 2 cut(s) 285, 728
BsrI ACTGG 4 cut(s) 98, 238, 364, 413
BssAI RCCGGY 2 cut(s) 285, 728
BssECI CCNNGG 4 cut(s) 142, 600, 606, 687
BssMI GATC 4 cut(s) 6, 422, 485, 591
BssT1I CCWWGG 1 cut(s) 142
Bst2UI CCWGG 1 cut(s) 420
Bst6I CTCTTC 1 cut(s) 23
BstDEI CTNAG 2 cut(s) 111, 595
BstDSI CCRYGG 2 cut(s) 142, 600
BstF5I GGATG 1 cut(s) 700
BstFNI CGCG 1 cut(s) 602
BstKTI GATC 4 cut(s) 9, 425, 488, 594
BstMBI GATC 4 cut(s) 6, 422, 485, 591
BstMWI GCNNNNNNNGC 4 cut(s) 532, 635, 680, 729
BstNI CCWGG 1 cut(s) 420
BstNSI RCATGY 1 cut(s) 324
BstSCI CCNGG 1 cut(s) 418
BstUI CGCG 1 cut(s) 602
BstV1I GCAGC 2 cut(s) 246, 647
BstV2I GAAGAC 1 cut(s) 705
BstX2I RGATCY 1 cut(s) 591
BstYI RGATCY 1 cut(s) 591
BsuRI GGCC 2 cut(s) 480, 605
BtgI CCRYGG 2 cut(s) 142, 600
BtsCI GGATG 1 cut(s) 700
BtsIMutI CAGTG 1 cut(s) 357
CaiI CAGNNNCTG 1 cut(s) 651
Cfr10I RCCGGY 2 cut(s) 285, 728
Cfr42I CCGCGG 1 cut(s) 603
CspAI ACCGGT 1 cut(s) 285
CviAII CATG 6 cut(s) 143, 185, 321, 385, 435, 476
DdeI CTNAG 2 cut(s) 111, 595
DpnI GATC 4 cut(s) 8, 424, 487, 593
DpnII GATC 4 cut(s) 6, 422, 485, 591
DraI TTTAAA 1 cut(s) 334
EaeI YGGCCR 1 cut(s) 478
Eam1104I CTCTTC 1 cut(s) 23
EarI CTCTTC 1 cut(s) 23
Eco130I CCWWGG 1 cut(s) 142
Eco57I CTGAAG 1 cut(s) 47
EcoRI GAATTC 1 cut(s) 104
EcoRII CCWGG 1 cut(s) 418
EcoT14I CCWWGG 1 cut(s) 142
ErhI CCWWGG 1 cut(s) 142
FaeI CATG 6 cut(s) 146, 188, 324, 388, 438, 479
FatI CATG 6 cut(s) 142, 184, 320, 384, 434, 475
FauNDI CATATG 1 cut(s) 247
Fnu4HI GCNGC 4 cut(s) 235, 600, 603, 636
FokI GGATG 1 cut(s) 707
Fsp4HI GCNGC 4 cut(s) 235, 600, 603, 636
FspBI CTAG 3 cut(s) 75, 326, 539
GluI GCNGC 4 cut(s) 235, 600, 603, 636
HaeIII GGCC 2 cut(s) 480, 605
HapII CCGG 4 cut(s) 286, 497, 675, 729
Hin1II CATG 6 cut(s) 146, 188, 324, 388, 438, 479
HindIII AAGCTT 1 cut(s) 208
HinfI GANTC 1 cut(s) 16
HpaII CCGG 4 cut(s) 286, 497, 675, 729
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 139
Hpy188I TCNGA 4 cut(s) 27, 610, 622, 743
Hpy188III TCNNGA 4 cut(s) 155, 326, 449, 497
Hpy8I GTNNAC 1 cut(s) 139
Hpy99I CGWCG 1 cut(s) 707
HpyAV CCTTC 4 cut(s) 494, 553, 627, 713
HpyCH4V TGCA 3 cut(s) 149, 416, 635
HpyF10VI GCNNNNNNNGC 4 cut(s) 532, 635, 680, 729
HpyF3I CTNAG 2 cut(s) 111, 595
Hsp92II CATG 6 cut(s) 146, 188, 324, 388, 438, 479
Kpn2I TCCGGA 1 cut(s) 496
KspI CCGCGG 1 cut(s) 603
Kzo9I GATC 4 cut(s) 6, 422, 485, 591
LmnI GCTCC 2 cut(s) 499, 582
Lsp1109I GCAGC 2 cut(s) 246, 647
LweI GCATC 3 cut(s) 544, 622, 670
MaeI CTAG 3 cut(s) 75, 326, 539
MalI GATC 4 cut(s) 8, 424, 487, 593
MboI GATC 4 cut(s) 6, 422, 485, 591
MboII GAAGA 3 cut(s) 40, 385, 710
MflI RGATCY 1 cut(s) 591
MlsI TGGCCA 1 cut(s) 480
MluCI AATT 8 cut(s) 21, 104, 173, 225, 253, 329, 348, 389
MluNI TGGCCA 1 cut(s) 480
Mox20I TGGCCA 1 cut(s) 480
MroI TCCGGA 1 cut(s) 496
MroXI GAANNNNTTC 1 cut(s) 444
MscI TGGCCA 1 cut(s) 480
MseI TTAA 6 cut(s) 213, 252, 291, 333, 396, 549
Msp20I TGGCCA 1 cut(s) 480
MspA1I CMGCKG 1 cut(s) 602
MspI CCGG 4 cut(s) 286, 497, 675, 729
MspR9I CCNGG 1 cut(s) 420
MvaI CCWGG 1 cut(s) 420
MvnI CGCG 1 cut(s) 602
MwoI GCNNNNNNNGC 4 cut(s) 532, 635, 680, 729
NcoI CCATGG 1 cut(s) 142
NdeI CATATG 1 cut(s) 247
NdeII GATC 4 cut(s) 6, 422, 485, 591
NlaIII CATG 6 cut(s) 146, 188, 324, 388, 438, 479
NspI RCATGY 1 cut(s) 324
PdmI GAANNNNTTC 1 cut(s) 444
PfeI GAWTC 1 cut(s) 16
PinAI ACCGGT 1 cut(s) 285
PkrI GCNGC 4 cut(s) 236, 601, 604, 637
Psp6I CCWGG 1 cut(s) 418
PspGI CCWGG 1 cut(s) 418
PstNI CAGNNNCTG 1 cut(s) 651
PsuI RGATCY 1 cut(s) 591
SacII CCGCGG 1 cut(s) 603
SaqAI TTAA 6 cut(s) 213, 252, 291, 333, 396, 549
SatI GCNGC 4 cut(s) 235, 600, 603, 636
Sau3AI GATC 4 cut(s) 6, 422, 485, 591
ScrFI CCNGG 1 cut(s) 420
SetI ASST 9 cut(s) 184, 212, 312, 341, 402, 421, 469, 547, 666
SfaNI GCATC 3 cut(s) 544, 622, 670
Sfr303I CCGCGG 1 cut(s) 603
SgrBI CCGCGG 1 cut(s) 603
Sse9I AATT 8 cut(s) 21, 104, 173, 225, 253, 329, 348, 389
SsiI CCGC 3 cut(s) 511, 600, 602
SspMI CTAG 3 cut(s) 75, 326, 539
StyD4I CCNGG 1 cut(s) 418
StyI CCWWGG 1 cut(s) 142
TaqI TCGA 1 cut(s) 273
TasI AATT 8 cut(s) 21, 104, 173, 225, 253, 329, 348, 389
TauI GCSGC 2 cut(s) 602, 605
TfiI GAWTC 1 cut(s) 16
Tru1I TTAA 6 cut(s) 213, 252, 291, 333, 396, 549
Tru9I TTAA 6 cut(s) 213, 252, 291, 333, 396, 549
TscAI CASTG 1 cut(s) 364
TseI GCWGC 2 cut(s) 234, 635
TspDTI ATGAA 6 cut(s) 234, 312, 386, 477, 711, 723
TspRI CASTG 1 cut(s) 364
XapI RAATTY 3 cut(s) 104, 225, 329
XbaI TCTAGA 1 cut(s) 325
XceI RCATGY 1 cut(s) 324
XmnI GAANNNNTTC 1 cut(s) 444
XspI CTAG 3 cut(s) 75, 326, 539
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.