Rmu_sc0000721.1_g000011

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000721.1
Physical Location & Seq
Reverse (-)
39863 .. 40147
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000721.1_g000011.1.cds

Sequence Viewer

Length: 285 bp
atgttgagcagagatgaggaagctaaagaaccagggtggaggaaaagggtgaatattgttgaaggtgtggctcatgtcttgtgttacatgcaccatgagtgcttgccaccaactgtgcaccgggacatatcaagcaagaatattttgctggattttgaatatggggcctgtgtttcagactttggcacagttaagttcttaaatccaaactcagctaattggattgcccttgcaggcacttacggatttgatgcaccagtaaatgcttttctctgctccccatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

94

Amino Acids

10.48

Weight (kDa)

5.7

Isoelectric Point (pI)

61.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031092)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000721.1_g000011 Rmu_sc0005913.1_g000022

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 62, 158
AjnI CCWGG 1 cut(s) 31
AluBI AGCT 2 cut(s) 23, 215
AluI AGCT 2 cut(s) 23, 215
Alw21I GWGCWC 1 cut(s) 120
Alw44I GTGCAC 1 cut(s) 116
AoxI GGCC 1 cut(s) 165
ApaLI GTGCAC 1 cut(s) 116
AspS9I GGNCC 1 cut(s) 165
AsuC2I CCSGG 1 cut(s) 122
AsuHPI GGTGA 1 cut(s) 61
BaeGI GKGCMC 1 cut(s) 120
Bbv12I GWGCWC 1 cut(s) 120
BciT130I CCWGG 1 cut(s) 33
BcnI CCSGG 1 cut(s) 122
Bme1390I CCNGG 2 cut(s) 33, 122
BmgT120I GGNCC 1 cut(s) 165
BmiI GGNNCC 1 cut(s) 166
BmrFI CCNGG 2 cut(s) 33, 122
BmsI GCATC 1 cut(s) 241
BpuMI CCSGG 1 cut(s) 122
BsaJI CCNNGG 1 cut(s) 32
Bse1I ACTGG 1 cut(s) 257
BseBI CCWGG 1 cut(s) 33
BseDI CCNNGG 1 cut(s) 32
BseMII CTCAG 1 cut(s) 225
BseNI ACTGG 1 cut(s) 257
BseSI GKGCMC 1 cut(s) 120
BshFI GGCC 1 cut(s) 167
BsiHKAI GWGCWC 1 cut(s) 120
BsiSI CCGG 1 cut(s) 121
BslFI GGGAC 1 cut(s) 137
BsmFI GGGAC 1 cut(s) 137
BsnI GGCC 1 cut(s) 167
Bsp1286I GDGCHC 1 cut(s) 120
BspANI GGCC 1 cut(s) 167
BspCNI CTCAG 1 cut(s) 224
BspLI GGNNCC 1 cut(s) 166
BsrI ACTGG 1 cut(s) 257
BssECI CCNNGG 1 cut(s) 32
Bst2UI CCWGG 1 cut(s) 33
Bst4CI ACNGT 2 cut(s) 115, 190
BstC8I GCNNGC 2 cut(s) 104, 235
BstDEI CTNAG 1 cut(s) 211
BstNI CCWGG 1 cut(s) 33
BstNSI RCATGY 1 cut(s) 91
BstSCI CCNGG 2 cut(s) 31, 120
BstSLI GKGCMC 1 cut(s) 120
BsuRI GGCC 1 cut(s) 167
Cac8I GCNNGC 2 cut(s) 104, 235
Cfr13I GGNCC 1 cut(s) 165
CviAII CATG 3 cut(s) 74, 88, 95
CviJI RGCY 4 cut(s) 23, 71, 167, 215
CviKI_1 RGCY 4 cut(s) 23, 71, 167, 215
DdeI CTNAG 1 cut(s) 211
EcoO109I RGGNCCY 1 cut(s) 165
EcoRII CCWGG 1 cut(s) 31
FaeI CATG 3 cut(s) 77, 91, 98
FaiI YATR 6 cut(s) 75, 89, 96, 128, 162, 283
FaqI GGGAC 1 cut(s) 137
FatI CATG 3 cut(s) 73, 87, 94
HaeIII GGCC 1 cut(s) 167
HapII CCGG 1 cut(s) 121
Hin1II CATG 3 cut(s) 77, 91, 98
HpaII CCGG 1 cut(s) 121
HphI GGTGA 1 cut(s) 61
Hpy166II GTNNAC 1 cut(s) 118
Hpy188I TCNGA 1 cut(s) 178
Hpy8I GTNNAC 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 56
HpyCH4III ACNGT 2 cut(s) 115, 190
HpyCH4V TGCA 4 cut(s) 91, 118, 233, 254
HpyF3I CTNAG 1 cut(s) 211
Hsp92II CATG 3 cut(s) 77, 91, 98
LmnI GCTCC 1 cut(s) 281
LpnPI CCDG 7 cut(s) 18, 45, 134, 134, 181, 219, 270
LweI GCATC 1 cut(s) 241
MaeIII GTNAC 1 cut(s) 83
MhlI GDGCHC 1 cut(s) 120
MluCI AATT 1 cut(s) 217
MnlI CCTC 2 cut(s) 10, 33
MseI TTAA 2 cut(s) 192, 200
MspI CCGG 1 cut(s) 121
MspR9I CCNGG 2 cut(s) 33, 122
MvaI CCWGG 1 cut(s) 33
NciI CCSGG 1 cut(s) 122
NlaIII CATG 3 cut(s) 77, 91, 98
NlaIV GGNNCC 1 cut(s) 166
NspI RCATGY 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 31
PspGI CCWGG 1 cut(s) 31
PspN4I GGNNCC 1 cut(s) 166
PspPI GGNCC 1 cut(s) 165
SaqAI TTAA 2 cut(s) 192, 200
Sau96I GGNCC 1 cut(s) 165
ScrFI CCNGG 2 cut(s) 33, 122
SduI GDGCHC 1 cut(s) 120
SetI ASST 3 cut(s) 25, 67, 217
SfaNI GCATC 1 cut(s) 241
Sse9I AATT 1 cut(s) 217
SspI AATATT 2 cut(s) 55, 142
StyD4I CCNGG 2 cut(s) 31, 120
TaaI ACNGT 2 cut(s) 115, 190
TasI AATT 1 cut(s) 217
Tru1I TTAA 2 cut(s) 192, 200
Tru9I TTAA 2 cut(s) 192, 200
TspGWI ACGGA 1 cut(s) 258
VneI GTGCAC 1 cut(s) 116
XceI RCATGY 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.