Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001167.1

Orthogroup ID

OG0025502

Physical Location & Seq

Genomic Coordinates Forward (+)

157461 .. 159273

Gene Structure 1813 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001167.1_g000036.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 729 bp

atgagcattgtagttaaaggtatagatttgagctatccaatgattcaagaagcctttgccgtcattgatatctcaagcaatagacttgaagggagcatcaatgaattcattgggaatcttaaggggcttcgctctctcaacatctccaataacattttcactggttccattccatcgttcttggggaacttaacgctgcttttggatgtttcccaagacaagttctcgggggagattcctcagcaacttgtgcatctcactttccttgcaaagttcaatgtctcccataacaatctcaccgaagaaaatgatccaattgaatttgattggaagtttgctatcgcggggtttggaagtgggttggttgtaggagttgttcttgcggaccttttgatcacaagatttcctgaatggtgggaatccactgcttccaaatcgccacatcgctgcacttgctcgggcctgagcccagtccgctgcgacctctccattcctgaaacaatgcgcctagaaagcatcctgcatcaatccgaacaaaaacctcaacctttactgttaaaacccttaaggccaagccatctcagaactcaaaagaccatagaccaaagcatcaccaatcccgcagcatcacagcgccgacaaggcgaagtcagaacgccatgggacgagaatgagattgcagaagttggcctcggtttggtggcggcatcttccttaggtcttggttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0008150 GO:0009888 GO:0010073 GO:0032501 GO:0032502 GO:0048507 GO:0048856

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_6 LRR_8

Protein Analysis

242

Amino Acids

26.62

Weight (kDa)

5.4

Isoelectric Point (pI)

49.69

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025502)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0001167.1_g000036
rosa_samantha	Rh4DG246900 Rh7DG435100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	344
AciI	CCGC	5 cut(s)	344, 383, 475, 621, 704
AclWI	GGATC	1 cut(s)	305
AcsI	RAATTY	2 cut(s)	104, 320
AfiI	CCNNNNNNNGG	1 cut(s)	697
AflII	CTTAAG	2 cut(s)	119, 565
AgsI	TTSAA	4 cut(s)	47, 89, 277, 320
AjuI	GAANNNNNNNTTGG	2 cut(s)	140, 172
AluBI	AGCT	1 cut(s)	33
AluI	AGCT	1 cut(s)	33
Alw26I	GTCTC	1 cut(s)	286
AlwI	GGATC	1 cut(s)	305
Ama87I	CYCGRG	2 cut(s)	226, 457
AoxI	GGCC	3 cut(s)	460, 569, 688
ApeKI	GCWGC	4 cut(s)	196, 447, 477, 623
ApoI	RAATTY	2 cut(s)	104, 320
AspLEI	GCGC	2 cut(s)	507, 636
AspS9I	GGNCC	2 cut(s)	385, 460
AsuHPI	GGTGA	2 cut(s)	289, 604
AvaI	CYCGRG	2 cut(s)	226, 457
AvaII	GGWCC	1 cut(s)	385
AxyI	CCTNAGG	1 cut(s)	715
BanII	GRGCYC	1 cut(s)	470
BbvCI	CCTCAGC	1 cut(s)	240
BbvI	GCAGC	4 cut(s)	183, 434, 464, 635
BccI	CCATC	2 cut(s)	181, 585
BceAI	ACGGC	1 cut(s)	44
BclI	TGATCA	1 cut(s)	393
BcoDI	GTCTC	1 cut(s)	286
BfaI	CTAG	1 cut(s)	509
BfoI	RGCGCY	1 cut(s)	637
BfrI	CTTAAG	2 cut(s)	119, 565
BglI	GCCNNNNNGGC	1 cut(s)	642
BisI	GCNGC	5 cut(s)	197, 448, 478, 624, 705
BlsI	GCNGC	5 cut(s)	198, 449, 479, 625, 706
Bme18I	GGWCC	1 cut(s)	385
BmeT110I	CYCGRG	2 cut(s)	226, 457
BmgT120I	GGNCC	2 cut(s)	385, 460
BmiI	GGNNCC	1 cut(s)	166
BmrI	ACTGGG	1 cut(s)	464
BmsI	GCATC	7 cut(s)	105, 262, 525, 532, 618, 635, 716
BmuI	ACTGGG	1 cut(s)	464
Bpu10I	CCTNAGC	2 cut(s)	240, 464
BpuEI	CTTGAG	1 cut(s)	58
BsaJI	CCNNGG	2 cut(s)	659, 691
Bsc4I	CCNNNNNNNGG	1 cut(s)	697
Bse1I	ACTGG	2 cut(s)	166, 470
Bse21I	CCTNAGG	1 cut(s)	715
BseDI	CCNNGG	2 cut(s)	659, 691
BseGI	GGATG	2 cut(s)	211, 516
BseLI	CCNNNNNNNGG	1 cut(s)	697
BseMII	CTCAG	3 cut(s)	254, 455, 595
BseNI	ACTGG	2 cut(s)	166, 470
BseXI	GCAGC	4 cut(s)	183, 434, 464, 635
BsgI	GTGCAG	1 cut(s)	433
Bsh1236I	CGCG	1 cut(s)	344
BshFI	GGCC	3 cut(s)	462, 571, 690
BsiHKCI	CYCGRG	2 cut(s)	226, 457
BslFI	GGGAC	1 cut(s)	677
BslI	CCNNNNNNNGG	1 cut(s)	697
BsmAI	GTCTC	1 cut(s)	286
BsmFI	GGGAC	1 cut(s)	677
BsnI	GGCC	3 cut(s)	462, 571, 690
BsoBI	CYCGRG	2 cut(s)	226, 457
Bsp1286I	GDGCHC	1 cut(s)	470
Bsp143I	GATC	2 cut(s)	310, 393
Bsp19I	CCATGG	1 cut(s)	659
BspACI	CCGC	5 cut(s)	344, 383, 475, 621, 704
BspANI	GGCC	3 cut(s)	462, 571, 690
BspCNI	CTCAG	3 cut(s)	253, 456, 594
BspFNI	CGCG	1 cut(s)	344
BspLI	GGNNCC	1 cut(s)	166
BspPI	GGATC	1 cut(s)	305
BspTI	CTTAAG	2 cut(s)	119, 565
BsrI	ACTGG	2 cut(s)	166, 470
BssECI	CCNNGG	2 cut(s)	659, 691
BssMI	GATC	2 cut(s)	310, 393
BssT1I	CCWWGG	1 cut(s)	659
Bst4CI	ACNGT	1 cut(s)	555
BstAFI	CTTAAG	2 cut(s)	119, 565
BstAPI	GCANNNNNTGC	1 cut(s)	250
BstDEI	CTNAG	4 cut(s)	240, 464, 581, 715
BstDSI	CCRYGG	1 cut(s)	659
BstF5I	GGATG	2 cut(s)	211, 516
BstFNI	CGCG	1 cut(s)	344
BstH2I	RGCGCY	1 cut(s)	637
BstHHI	GCGC	2 cut(s)	507, 636
BstKTI	GATC	2 cut(s)	313, 396
BstMAI	GTCTC	1 cut(s)	286
BstMBI	GATC	2 cut(s)	310, 393
BstMWI	GCNNNNNNNGC	5 cut(s)	250, 453, 474, 513, 642
BstUI	CGCG	1 cut(s)	344
BstV1I	GCAGC	4 cut(s)	183, 434, 464, 635
Bsu36I	CCTNAGG	1 cut(s)	715
BsuRI	GGCC	3 cut(s)	462, 571, 690
BtgI	CCRYGG	1 cut(s)	659
BtgZI	GCGATG	1 cut(s)	428
BtsCI	GGATG	2 cut(s)	211, 516
BtsI	GCAGTG	1 cut(s)	423
BtsIMutI	CAGTG	2 cut(s)	159, 423
CfoI	GCGC	2 cut(s)	507, 636
Cfr13I	GGNCC	2 cut(s)	385, 460
CviAII	CATG	1 cut(s)	660
CviJI	RGCY	8 cut(s)	33, 53, 127, 462, 468, 571, 576, 690
CviKI_1	RGCY	8 cut(s)	33, 53, 127, 462, 468, 571, 576, 690
DdeI	CTNAG	4 cut(s)	240, 464, 581, 715
DpnI	GATC	2 cut(s)	312, 395
DpnII	GATC	2 cut(s)	310, 393
Eco130I	CCWWGG	1 cut(s)	659
Eco24I	GRGCYC	1 cut(s)	470
Eco32I	GATATC	1 cut(s)	70
Eco47I	GGWCC	1 cut(s)	385
Eco81I	CCTNAGG	1 cut(s)	715
Eco88I	CYCGRG	2 cut(s)	226, 457
EcoRI	GAATTC	1 cut(s)	104
EcoRV	GATATC	1 cut(s)	70
EcoT14I	CCWWGG	1 cut(s)	659
EcoT38I	GRGCYC	1 cut(s)	470
ErhI	CCWWGG	1 cut(s)	659
FaeI	CATG	1 cut(s)	663
FaiI	YATR	4 cut(s)	23, 288, 599, 661
FaqI	GGGAC	1 cut(s)	677
FatI	CATG	1 cut(s)	659
FauI	CCCGC	2 cut(s)	337, 628
FbaI	TGATCA	1 cut(s)	393
Fnu4HI	GCNGC	5 cut(s)	197, 448, 478, 624, 705
FokI	GGATG	2 cut(s)	218, 503
FriOI	GRGCYC	1 cut(s)	470
Fsp4HI	GCNGC	5 cut(s)	197, 448, 478, 624, 705
FspBI	CTAG	1 cut(s)	509
GlaI	GCGC	2 cut(s)	506, 635
GluI	GCNGC	5 cut(s)	197, 448, 478, 624, 705
HaeII	RGCGCY	1 cut(s)	637
HaeIII	GGCC	3 cut(s)	462, 571, 690
HhaI	GCGC	2 cut(s)	507, 636
Hin1II	CATG	1 cut(s)	663
Hin6I	GCGC	2 cut(s)	505, 634
HinP1I	GCGC	2 cut(s)	505, 634
HinfI	GANTC	4 cut(s)	43, 115, 235, 419
HphI	GGTGA	2 cut(s)	289, 604
Hpy188I	TCNGA	3 cut(s)	532, 584, 653
Hpy188III	TCNNGA	3 cut(s)	47, 407, 494
HpyAV	CCTTC	1 cut(s)	83
HpyCH4III	ACNGT	1 cut(s)	555
HpyCH4V	TGCA	5 cut(s)	253, 269, 450, 523, 680
HpyF10VI	GCNNNNNNNGC	5 cut(s)	250, 453, 474, 513, 642
HpyF3I	CTNAG	4 cut(s)	240, 464, 581, 715
Hsp92II	CATG	1 cut(s)	663
HspAI	GCGC	2 cut(s)	505, 634
Ksp22I	TGATCA	1 cut(s)	393
Kzo9I	GATC	2 cut(s)	310, 393
LmnI	GCTCC	1 cut(s)	93
LpnPI	CCDG	6 cut(s)	147, 420, 476, 483, 507, 533
Lsp1109I	GCAGC	4 cut(s)	183, 434, 464, 635
LweI	GCATC	7 cut(s)	105, 262, 525, 532, 618, 635, 716
MaeI	CTAG	1 cut(s)	509
MalI	GATC	2 cut(s)	312, 395
MboI	GATC	2 cut(s)	310, 393
MboII	GAAGA	2 cut(s)	314, 702
MfeI	CAATTG	1 cut(s)	315
MhlI	GDGCHC	1 cut(s)	470
MluCI	AATT	3 cut(s)	104, 315, 320
MnlI	CCTC	4 cut(s)	249, 494, 552, 701
MseI	TTAA	6 cut(s)	15, 120, 191, 557, 566, 727
MspA1I	CMGCKG	1 cut(s)	477
MspCI	CTTAAG	2 cut(s)	119, 565
MunI	CAATTG	1 cut(s)	315
MvnI	CGCG	1 cut(s)	344
MwoI	GCNNNNNNNGC	5 cut(s)	250, 453, 474, 513, 642
NcoI	CCATGG	1 cut(s)	659
NdeII	GATC	2 cut(s)	310, 393
NlaIII	CATG	1 cut(s)	663
NlaIV	GGNNCC	1 cut(s)	166
PfeI	GAWTC	4 cut(s)	43, 115, 235, 419
PkrI	GCNGC	5 cut(s)	198, 449, 479, 625, 706
PspN4I	GGNNCC	1 cut(s)	166
PspPI	GGNCC	2 cut(s)	385, 460
PsrI	GAACNNNNNNTAC	2 cut(s)	360, 392
SaqAI	TTAA	6 cut(s)	15, 120, 191, 557, 566, 727
SatI	GCNGC	5 cut(s)	197, 448, 478, 624, 705
Sau3AI	GATC	2 cut(s)	310, 393
Sau96I	GGNCC	2 cut(s)	385, 460
SduI	GDGCHC	1 cut(s)	470
SetI	ASST	7 cut(s)	22, 35, 390, 486, 544, 550, 721
SfaNI	GCATC	7 cut(s)	105, 262, 525, 532, 618, 635, 716
SinI	GGWCC	1 cut(s)	385
SmlI	CTYRAG	3 cut(s)	73, 119, 565
SmoI	CTYRAG	3 cut(s)	73, 119, 565
Sse9I	AATT	3 cut(s)	104, 315, 320
SsiI	CCGC	5 cut(s)	344, 383, 475, 621, 704
SspMI	CTAG	1 cut(s)	509
StyI	CCWWGG	1 cut(s)	659
TaaI	ACNGT	1 cut(s)	555
TasI	AATT	3 cut(s)	104, 315, 320
TauI	GCSGC	1 cut(s)	707
TfiI	GAWTC	4 cut(s)	43, 115, 235, 419
Tru1I	TTAA	6 cut(s)	15, 120, 191, 557, 566, 727
Tru9I	TTAA	6 cut(s)	15, 120, 191, 557, 566, 727
TscAI	CASTG	2 cut(s)	166, 430
TseI	GCWGC	4 cut(s)	196, 447, 477, 623
TspDTI	ATGAA	2 cut(s)	97, 117
TspRI	CASTG	2 cut(s)	166, 430
Vha464I	CTTAAG	2 cut(s)	119, 565
VpaK11BI	GGWCC	1 cut(s)	385
XapI	RAATTY	2 cut(s)	104, 320
XspI	CTAG	1 cut(s)	509

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.