Rmu_sc0001198.1_g000014

Pentatricopeptide repeat domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001198.1
OG0025503
Physical Location & Seq
Forward (+)
72956 .. 73216
261 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 261 bp
atgatcaatggatatgcgaaagtggggaactcggtggattcaagaaagctttttgatgggatgccgaatagggatgtgatctcctggacgtccttgatcaccggttattctcaagctaaccatcatgctgaggcggtgagtctttttggtgaaatgatggcagctaatgtgaggccggataaagtgacagtggctagtgtgctttctgcttgtgcgcatgtgggatggataagaaagactcggtgtcatggacttcggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03008 map03008
Pfam Domains
Protein Families
PPR PPR_2

Protein Analysis

86

Amino Acids

9.4

Weight (kDa)

9.51

Isoelectric Point (pI)

21.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 24 - 73 2.4e-12 PPR repeat family
PPR PF01535 27 - 56 3.8e-07 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025503)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001198.1_g000014
rosa_samantha Rh1AG409500 Rh1AG410100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 92
Acc16I TGCGCA 1 cut(s) 216
AciI CCGC 1 cut(s) 134
AcyI GRCGYC 1 cut(s) 89
AgeI ACCGGT 1 cut(s) 101
AgsI TTSAA 1 cut(s) 42
AhdI GACNNNNNGTC 1 cut(s) 243
AjnI CCWGG 1 cut(s) 83
AluBI AGCT 3 cut(s) 49, 116, 164
AluI AGCT 3 cut(s) 49, 116, 164
AoxI GGCC 1 cut(s) 173
ApeKI GCWGC 1 cut(s) 161
AsiGI ACCGGT 1 cut(s) 101
AspLEI GCGC 1 cut(s) 217
AsuHPI GGTGA 3 cut(s) 91, 148, 161
BbvCI CCTCAGC 1 cut(s) 129
BbvI GCAGC 1 cut(s) 173
BccI CCATC 4 cut(s) 50, 129, 151, 219
BciT130I CCWGG 1 cut(s) 85
BclI TGATCA 2 cut(s) 3, 96
BfaI CTAG 1 cut(s) 195
BisI GCNGC 1 cut(s) 162
BlsI GCNGC 1 cut(s) 163
Bme1390I CCNGG 1 cut(s) 85
BmeRI GACNNNNNGTC 1 cut(s) 243
BmrFI CCNGG 1 cut(s) 85
BmsI GCATC 1 cut(s) 51
Bpu10I CCTNAGC 1 cut(s) 129
BpuEI CTTGAG 1 cut(s) 96
BsaHI GRCGYC 1 cut(s) 89
BsaWI WCCGGW 1 cut(s) 101
Bse118I RCCGGY 1 cut(s) 101
BseBI CCWGG 1 cut(s) 85
BseGI GGATG 3 cut(s) 66, 79, 230
BseMII CTCAG 1 cut(s) 120
BseXI GCAGC 1 cut(s) 173
BshFI GGCC 1 cut(s) 175
BshTI ACCGGT 1 cut(s) 101
BsiSI CCGG 2 cut(s) 102, 176
BsnI GGCC 1 cut(s) 175
Bsp143I GATC 3 cut(s) 3, 78, 96
BspACI CCGC 1 cut(s) 134
BspANI GGCC 1 cut(s) 175
BspCNI CTCAG 1 cut(s) 121
BsrFI RCCGGY 1 cut(s) 101
BssAI RCCGGY 1 cut(s) 101
BssMI GATC 3 cut(s) 3, 78, 96
BssNI GRCGYC 1 cut(s) 89
Bst2UI CCWGG 1 cut(s) 85
Bst4CI ACNGT 1 cut(s) 190
BstACI GRCGYC 1 cut(s) 89
BstDEI CTNAG 1 cut(s) 129
BstF5I GGATG 3 cut(s) 66, 79, 230
BstHHI GCGC 1 cut(s) 217
BstKTI GATC 3 cut(s) 6, 81, 99
BstMBI GATC 3 cut(s) 3, 78, 96
BstNI CCWGG 1 cut(s) 85
BstNSI RCATGY 1 cut(s) 221
BstSCI CCNGG 1 cut(s) 83
BstV1I GCAGC 1 cut(s) 173
BsuRI GGCC 1 cut(s) 175
BtsCI GGATG 3 cut(s) 66, 79, 230
BtsIMutI CAGTG 1 cut(s) 195
CfoI GCGC 1 cut(s) 217
Cfr10I RCCGGY 1 cut(s) 101
CspAI ACCGGT 1 cut(s) 101
CviAII CATG 3 cut(s) 125, 218, 248
CviJI RGCY 5 cut(s) 49, 116, 164, 175, 194
CviKI_1 RGCY 5 cut(s) 49, 116, 164, 175, 194
DdeI CTNAG 1 cut(s) 129
DpnI GATC 3 cut(s) 5, 80, 98
DpnII GATC 3 cut(s) 3, 78, 96
DriI GACNNNNNGTC 1 cut(s) 243
Eam1105I GACNNNNNGTC 1 cut(s) 243
EcoRII CCWGG 1 cut(s) 83
FaeI CATG 3 cut(s) 128, 221, 251
FaiI YATR 4 cut(s) 15, 126, 219, 249
FatI CATG 3 cut(s) 124, 217, 247
FbaI TGATCA 2 cut(s) 3, 96
Fnu4HI GCNGC 1 cut(s) 162
FokI GGATG 3 cut(s) 73, 86, 237
Fsp4HI GCNGC 1 cut(s) 162
FspAI RTGCGCAY 1 cut(s) 216
FspBI CTAG 1 cut(s) 195
FspI TGCGCA 1 cut(s) 216
GlaI GCGC 1 cut(s) 216
GluI GCNGC 1 cut(s) 162
HaeIII GGCC 1 cut(s) 175
HapII CCGG 2 cut(s) 102, 176
HhaI GCGC 1 cut(s) 217
Hin1I GRCGYC 1 cut(s) 89
Hin1II CATG 3 cut(s) 128, 221, 251
Hin6I GCGC 1 cut(s) 215
HinP1I GCGC 1 cut(s) 215
HindIII AAGCTT 1 cut(s) 47
HinfI GANTC 3 cut(s) 38, 139, 238
HpaII CCGG 2 cut(s) 102, 176
HphI GGTGA 3 cut(s) 91, 148, 161
Hpy188III TCNNGA 1 cut(s) 42
HpyCH4III ACNGT 1 cut(s) 190
HpyCH4IV ACGT 1 cut(s) 89
HpyF3I CTNAG 1 cut(s) 129
HpySE526I ACGT 1 cut(s) 89
Hsp92I GRCGYC 1 cut(s) 89
Hsp92II CATG 3 cut(s) 128, 221, 251
HspAI GCGC 1 cut(s) 215
Ksp22I TGATCA 2 cut(s) 3, 96
Kzo9I GATC 3 cut(s) 3, 78, 96
LpnPI CCDG 4 cut(s) 70, 97, 115, 189
Lsp1109I GCAGC 1 cut(s) 173
LweI GCATC 1 cut(s) 51
MaeI CTAG 1 cut(s) 195
MaeII ACGT 1 cut(s) 89
MaeIII GTNAC 1 cut(s) 184
MalI GATC 3 cut(s) 5, 80, 98
MboI GATC 3 cut(s) 3, 78, 96
MlyI GAGTC 2 cut(s) 148, 232
MnlI CCTC 2 cut(s) 124, 165
MspI CCGG 2 cut(s) 102, 176
MspR9I CCNGG 1 cut(s) 85
MvaI CCWGG 1 cut(s) 85
NdeII GATC 3 cut(s) 3, 78, 96
NlaIII CATG 3 cut(s) 128, 221, 251
NmuCI GTSAC 1 cut(s) 184
NsbI TGCGCA 1 cut(s) 216
NspI RCATGY 1 cut(s) 221
PfeI GAWTC 1 cut(s) 38
PfoI TCCNGGA 1 cut(s) 83
PinAI ACCGGT 1 cut(s) 101
PkrI GCNGC 1 cut(s) 163
PleI GAGTC 2 cut(s) 147, 232
PpsI GAGTC 2 cut(s) 147, 232
Psp6I CCWGG 1 cut(s) 83
PspGI CCWGG 1 cut(s) 83
SatI GCNGC 1 cut(s) 162
Sau3AI GATC 3 cut(s) 3, 78, 96
SchI GAGTC 2 cut(s) 148, 232
ScrFI CCNGG 1 cut(s) 85
SetI ASST 4 cut(s) 51, 92, 118, 166
SfaNI GCATC 1 cut(s) 51
SmlI CTYRAG 1 cut(s) 111
SmoI CTYRAG 1 cut(s) 111
SsiI CCGC 1 cut(s) 134
SspMI CTAG 1 cut(s) 195
StyD4I CCNGG 1 cut(s) 83
TaaI ACNGT 1 cut(s) 190
TaiI ACGT 1 cut(s) 92
TfiI GAWTC 1 cut(s) 38
TscAI CASTG 1 cut(s) 195
TseFI GTSAC 1 cut(s) 184
TseI GCWGC 1 cut(s) 161
Tsp45I GTSAC 1 cut(s) 184
TspRI CASTG 1 cut(s) 195
XceI RCATGY 1 cut(s) 221
XspI CTAG 1 cut(s) 195
ZraI GACGTC 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.