Rmu_sc0001228.1_g000012

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001228.1
OG0023537
Physical Location & Seq
Reverse (-)
82934 .. 84905
1972 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 864 bp
atgtttgcagatgactgcctaatttttgcaaaaggaactaaaaagagtgcaaggaacatagctcaagtcctgaccttcttctcttcagcctcagaccagaagatgagctatcataaatcttccatgttcttctttcctaaggataactctggtctcaaaagggatattgttaacatcttgaacattcagcaaaagtctacatttagtaagtaccttggcatccataatgtaattttttggaaagatcctgtcaatgctaaagagctgctcttgaagatgtctaataagttggcaggttggaaaaaatcttctctgtcaagagcaggtagattaattcttattcagtctaatcttgctggcatgccaaatcacactatgtcctgctttaaatgccctaagagcttaacacatcaaattgacaaacaggctaaagcttttttctggggctcagattcaaaatgcccccctatggcttcgaacaaacctcagctggcatgcttaaaagcttcactgaagctaatggtgcaaccaggtagaaaccagagaattacaattagatgggaacccccaaaagaagatcatgtgaagataaattttgatggctttgtccatagagattcagctgcaggaggttttgtcattagaaaccatgttggtaaacctctgtttgcagcctctattccaactggaagtgcaactcttccagttgctgaggcaatagctctccaaaacagtttaattcatgcaaaggaaaaagggctcagaatcatggaagtggaaggagactccatggttagtaatcgatgcagtaaatggagtgattactcccccatggagattaatcataattgttcaagatattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

287

Amino Acids

32.13

Weight (kDa)

9.81

Isoelectric Point (pI)

52.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 198 - 266 1.4e-07 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023537)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001228.1_g000012
rosa_rugosa Rorug05G0574600 Rorug05G0574700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 284, 314
AccI GTMKAC 1 cut(s) 197
AclWI GGATC 1 cut(s) 239
AcsI RAATTY 1 cut(s) 592
AcuI CTGAAG 2 cut(s) 69, 533
AfaI GTAC 1 cut(s) 212
AfiI CCNNNNNNNGG 1 cut(s) 469
AgsI TTSAA 4 cut(s) 181, 274, 456, 855
AjnI CCWGG 1 cut(s) 529
Alw26I GTCTC 2 cut(s) 158, 777
AlwI GGATC 1 cut(s) 239
AlwNI CAGNNNCTG 1 cut(s) 710
ApeKI GCWGC 3 cut(s) 265, 623, 671
ApoI RAATTY 1 cut(s) 592
AseI ATTAAT 2 cut(s) 332, 840
AsuII TTCGAA 1 cut(s) 476
AxyI CCTNAGG 1 cut(s) 138
BanII GRGCYC 2 cut(s) 449, 762
BbvCI CCTCAGC 2 cut(s) 486, 711
BbvI GCAGC 3 cut(s) 252, 610, 683
BccI CCATC 2 cut(s) 552, 593
BciT130I CCWGG 1 cut(s) 531
BcoDI GTCTC 2 cut(s) 158, 777
BfmI CTRYAG 1 cut(s) 624
BfuAI ACCTGC 2 cut(s) 284, 314
BisI GCNGC 3 cut(s) 266, 624, 672
BlsI GCNGC 3 cut(s) 267, 625, 673
Bme1390I CCNGG 1 cut(s) 531
BmiI GGNNCC 1 cut(s) 564
BmrFI CCNGG 1 cut(s) 531
BmsI GCATC 2 cut(s) 228, 794
Bpu10I CCTNAGC 2 cut(s) 486, 711
Bpu14I TTCGAA 1 cut(s) 476
BpuEI CTTGAG 1 cut(s) 48
Bsa29I ATCGAT 1 cut(s) 802
BsaI GGTCTC 1 cut(s) 158
BsaJI CCNNGG 3 cut(s) 214, 789, 831
BsaXI ACNNNNNCTCC 2 cut(s) 621, 651
Bsc4I CCNNNNNNNGG 1 cut(s) 469
Bse1I ACTGG 2 cut(s) 691, 704
Bse21I CCTNAGG 1 cut(s) 138
BseBI CCWGG 1 cut(s) 531
BseCI ATCGAT 1 cut(s) 802
BseDI CCNNGG 3 cut(s) 214, 789, 831
BseGI GGATG 1 cut(s) 219
BseLI CCNNNNNNNGG 1 cut(s) 469
BseMII CTCAG 5 cut(s) 105, 462, 500, 702, 775
BseNI ACTGG 2 cut(s) 691, 704
BseXI GCAGC 3 cut(s) 252, 610, 683
BshVI ATCGAT 1 cut(s) 802
BslI CCNNNNNNNGG 1 cut(s) 469
BsmAI GTCTC 2 cut(s) 158, 777
Bso31I GGTCTC 1 cut(s) 158
Bsp119I TTCGAA 1 cut(s) 476
Bsp1286I GDGCHC 2 cut(s) 449, 762
Bsp143I GATC 2 cut(s) 244, 577
Bsp19I CCATGG 2 cut(s) 789, 831
BspCNI CTCAG 5 cut(s) 104, 461, 499, 703, 774
BspDI ATCGAT 1 cut(s) 802
BspLI GGNNCC 1 cut(s) 564
BspMAI CTGCAG 1 cut(s) 628
BspMI ACCTGC 2 cut(s) 284, 314
BspPI GGATC 1 cut(s) 239
BspT104I TTCGAA 1 cut(s) 476
BspTNI GGTCTC 1 cut(s) 158
BsrI ACTGG 2 cut(s) 691, 704
BssECI CCNNGG 3 cut(s) 214, 789, 831
BssMI GATC 2 cut(s) 244, 577
BssT1I CCWWGG 3 cut(s) 214, 789, 831
Bst2UI CCWGG 1 cut(s) 531
Bst4CI ACNGT 1 cut(s) 734
Bst6I CTCTTC 2 cut(s) 88, 705
BstBI TTCGAA 1 cut(s) 476
BstC8I GCNNGC 4 cut(s) 358, 362, 492, 496
BstDEI CTNAG 7 cut(s) 91, 138, 396, 448, 486, 711, 761
BstDSI CCRYGG 2 cut(s) 789, 831
BstF5I GGATG 1 cut(s) 219
BstKTI GATC 2 cut(s) 247, 580
BstMAI GTCTC 2 cut(s) 158, 777
BstMBI GATC 2 cut(s) 244, 577
BstMWI GCNNNNNNNGC 3 cut(s) 390, 399, 523
BstNI CCWGG 1 cut(s) 531
BstNSI RCATGY 2 cut(s) 364, 498
BstSCI CCNGG 1 cut(s) 529
BstSFI CTRYAG 1 cut(s) 624
BstV1I GCAGC 3 cut(s) 252, 610, 683
BstX2I RGATCY 1 cut(s) 244
BstYI RGATCY 1 cut(s) 244
Bsu15I ATCGAT 1 cut(s) 802
Bsu36I CCTNAGG 1 cut(s) 138
BsuTUI ATCGAT 1 cut(s) 802
BtgI CCRYGG 2 cut(s) 789, 831
BtsCI GGATG 1 cut(s) 219
BtsIMutI CAGTG 1 cut(s) 509
BveI ACCTGC 2 cut(s) 284, 314
Cac8I GCNNGC 4 cut(s) 358, 362, 492, 496
CaiI CAGNNNCTG 1 cut(s) 710
ClaI ATCGAT 1 cut(s) 802
CsiI ACCWGGT 1 cut(s) 529
Csp6I GTAC 1 cut(s) 211
CviAII CATG 9 cut(s) 124, 361, 495, 581, 650, 743, 769, 790, 832
CviQI GTAC 1 cut(s) 211
DdeI CTNAG 7 cut(s) 91, 138, 396, 448, 486, 711, 761
DpnI GATC 2 cut(s) 246, 579
DpnII GATC 2 cut(s) 244, 577
DraI TTTAAA 1 cut(s) 388
Eam1104I CTCTTC 2 cut(s) 88, 705
EarI CTCTTC 2 cut(s) 88, 705
Eco130I CCWWGG 3 cut(s) 214, 789, 831
Eco24I GRGCYC 2 cut(s) 449, 762
Eco31I GGTCTC 1 cut(s) 158
Eco57I CTGAAG 2 cut(s) 69, 533
Eco81I CCTNAGG 1 cut(s) 138
EcoRII CCWGG 1 cut(s) 529
EcoT14I CCWWGG 3 cut(s) 214, 789, 831
EcoT38I GRGCYC 2 cut(s) 449, 762
ErhI CCWWGG 3 cut(s) 214, 789, 831
FaeI CATG 9 cut(s) 127, 364, 498, 584, 653, 746, 772, 793, 835
FatI CATG 9 cut(s) 123, 360, 494, 580, 649, 742, 768, 789, 831
FblI GTMKAC 1 cut(s) 197
Fnu4HI GCNGC 3 cut(s) 266, 624, 672
FokI GGATG 1 cut(s) 206
FriOI GRGCYC 2 cut(s) 449, 762
Fsp4HI GCNGC 3 cut(s) 266, 624, 672
GluI GCNGC 3 cut(s) 266, 624, 672
Hin1II CATG 9 cut(s) 127, 364, 498, 584, 653, 746, 772, 793, 835
HincII GTYRAC 1 cut(s) 172
HindII GTYRAC 1 cut(s) 172
HindIII AAGCTT 2 cut(s) 432, 504
HinfI GANTC 4 cut(s) 452, 617, 765, 785
HpaI GTTAAC 1 cut(s) 172
Hpy166II GTNNAC 3 cut(s) 172, 198, 659
Hpy188I TCNGA 3 cut(s) 94, 451, 764
Hpy188III TCNNGA 5 cut(s) 70, 178, 271, 318, 855
Hpy8I GTNNAC 3 cut(s) 172, 198, 659
HpyAV CCTTC 2 cut(s) 85, 773
HpyCH4III ACNGT 1 cut(s) 734
HpyCH4V TGCA 9 cut(s) 8, 29, 50, 526, 626, 671, 695, 746, 807
HpyF10VI GCNNNNNNNGC 3 cut(s) 390, 399, 523
HpyF3I CTNAG 7 cut(s) 91, 138, 396, 448, 486, 711, 761
Hsp92II CATG 9 cut(s) 127, 364, 498, 584, 653, 746, 772, 793, 835
KspAI GTTAAC 1 cut(s) 172
Kzo9I GATC 2 cut(s) 244, 577
Lsp1109I GCAGC 3 cut(s) 252, 610, 683
LweI GCATC 2 cut(s) 228, 794
MabI ACCWGGT 1 cut(s) 529
MalI GATC 2 cut(s) 246, 579
MboI GATC 2 cut(s) 244, 577
MflI RGATCY 1 cut(s) 244
MhlI GDGCHC 2 cut(s) 449, 762
MluCI AATT 9 cut(s) 21, 231, 333, 414, 546, 552, 592, 738, 847
MlyI GAGTC 1 cut(s) 779
MmeI TCCRAC 2 cut(s) 278, 707
MnlI CCTC 6 cut(s) 100, 495, 623, 672, 685, 706
MseI TTAA 7 cut(s) 171, 332, 387, 404, 500, 737, 840
MslI CAYNNNNRTG 1 cut(s) 773
MspA1I CMGCKG 2 cut(s) 490, 623
MspR9I CCNGG 1 cut(s) 531
MvaI CCWGG 1 cut(s) 531
MwoI GCNNNNNNNGC 3 cut(s) 390, 399, 523
NcoI CCATGG 2 cut(s) 789, 831
NdeII GATC 2 cut(s) 244, 577
NlaIII CATG 9 cut(s) 127, 364, 498, 584, 653, 746, 772, 793, 835
NlaIV GGNNCC 1 cut(s) 564
NspI RCATGY 2 cut(s) 364, 498
NspV TTCGAA 1 cut(s) 476
PaeI GCATGC 2 cut(s) 364, 498
PfeI GAWTC 3 cut(s) 452, 617, 765
PkrI GCNGC 3 cut(s) 267, 625, 673
PleI GAGTC 1 cut(s) 779
PpsI GAGTC 1 cut(s) 779
PshBI ATTAAT 2 cut(s) 332, 840
Psp6I CCWGG 1 cut(s) 529
PspGI CCWGG 1 cut(s) 529
PspN4I GGNNCC 1 cut(s) 564
PstI CTGCAG 1 cut(s) 628
PstNI CAGNNNCTG 1 cut(s) 710
PsuI RGATCY 1 cut(s) 244
PvuII CAGCTG 2 cut(s) 490, 623
RsaI GTAC 1 cut(s) 212
RsaNI GTAC 1 cut(s) 211
RseI CAYNNNNRTG 1 cut(s) 773
SaqAI TTAA 7 cut(s) 171, 332, 387, 404, 500, 737, 840
SatI GCNGC 3 cut(s) 266, 624, 672
Sau3AI GATC 2 cut(s) 244, 577
SchI GAGTC 1 cut(s) 779
ScrFI CCNGG 1 cut(s) 531
SduI GDGCHC 2 cut(s) 449, 762
SexAI ACCWGGT 1 cut(s) 529
SfaNI GCATC 2 cut(s) 228, 794
SfcI CTRYAG 1 cut(s) 624
SfuI TTCGAA 1 cut(s) 476
SmiMI CAYNNNNRTG 1 cut(s) 773
SmlI CTYRAG 1 cut(s) 63
SmoI CTYRAG 1 cut(s) 63
SphI GCATGC 2 cut(s) 364, 498
Sse9I AATT 9 cut(s) 21, 231, 333, 414, 546, 552, 592, 738, 847
StyD4I CCNGG 1 cut(s) 529
StyI CCWWGG 3 cut(s) 214, 789, 831
TaaI ACNGT 1 cut(s) 734
TaqI TCGA 2 cut(s) 476, 802
TasI AATT 9 cut(s) 21, 231, 333, 414, 546, 552, 592, 738, 847
TfiI GAWTC 3 cut(s) 452, 617, 765
Tru1I TTAA 7 cut(s) 171, 332, 387, 404, 500, 737, 840
Tru9I TTAA 7 cut(s) 171, 332, 387, 404, 500, 737, 840
TscAI CASTG 1 cut(s) 516
TseI GCWGC 3 cut(s) 265, 623, 671
TspDTI ATGAA 1 cut(s) 731
TspRI CASTG 1 cut(s) 516
VspI ATTAAT 2 cut(s) 332, 840
XapI RAATTY 1 cut(s) 592
XceI RCATGY 2 cut(s) 364, 498
XmiI GTMKAC 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.