Rmu_sc0001517.1_g000012

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001517.1
OG0031005
Physical Location & Seq
Forward (+)
33795 .. 34609
815 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001517.1_g000012.1.cds

Sequence Viewer

Length: 369 bp
atgtgctcggctttccatggcgaagcggaggcctgtagggctggattgcttattgtaatacatcagggttggaagcaggtggagctggaaaccgactgtgctatcctagctactgcccttaaccaacaaatggaggataactctgagaccctcctggttaagatttctggctacgtcactatccccagcgtcgtcgtcctcactcgttgtcgatgtcagcctcgagcaaaacagttgccaacccaagccaacaacccggtcagcgtataccgtactccgcttgacaacgacaagacagaagacgaagaaccttgcaccaccgcagacaaggccggtgaccaccatctgggaattagatctgccacctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

122

Amino Acids

13.35

Weight (kDa)

5.25

Isoelectric Point (pI)

32.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031005)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001517.1_g000012 Rmu_ssc0000118.1_g000022

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 67
Acc36I ACCTGC 1 cut(s) 67
AccB7I CCANNNNNTGG 2 cut(s) 130, 346
AccI GTMKAC 1 cut(s) 267
AciI CCGC 3 cut(s) 26, 278, 321
AfaI GTAC 1 cut(s) 274
AfiI CCNNNNNNNGG 2 cut(s) 130, 346
AjnI CCWGG 1 cut(s) 153
AluBI AGCT 2 cut(s) 85, 110
AluI AGCT 2 cut(s) 85, 110
Alw21I GWGCWC 1 cut(s) 8
Alw26I GTCTC 1 cut(s) 140
Ama87I CYCGRG 1 cut(s) 222
AoxI GGCC 2 cut(s) 30, 330
AsuC2I CCSGG 1 cut(s) 257
AsuHPI GGTGA 1 cut(s) 347
AvaI CYCGRG 1 cut(s) 222
BbsI GAAGAC 1 cut(s) 306
Bbv12I GWGCWC 1 cut(s) 8
BccI CCATC 1 cut(s) 351
BciT130I CCWGG 1 cut(s) 155
BcnI CCSGG 1 cut(s) 257
BcoDI GTCTC 1 cut(s) 140
BfaI CTAG 2 cut(s) 107, 367
BfmI CTRYAG 1 cut(s) 34
BfuAI ACCTGC 1 cut(s) 67
BglI GCCNNNNNGGC 1 cut(s) 38
BglII AGATCT 1 cut(s) 356
Bme1390I CCNGG 2 cut(s) 155, 257
BmeT110I CYCGRG 1 cut(s) 222
BmrFI CCNGG 2 cut(s) 155, 257
BpiI GAAGAC 1 cut(s) 306
BplI GAGNNNNNCTC 2 cut(s) 125, 157
BpuMI CCSGG 1 cut(s) 257
BsaI GGTCTC 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 16
Bsc4I CCNNNNNNNGG 2 cut(s) 130, 346
Bse118I RCCGGY 1 cut(s) 332
BseBI CCWGG 1 cut(s) 155
BseDI CCNNGG 1 cut(s) 16
BseLI CCNNNNNNNGG 2 cut(s) 130, 346
BseMII CTCAG 1 cut(s) 135
BseYI CCCAGC 1 cut(s) 185
BshFI GGCC 2 cut(s) 32, 332
BsiHKAI GWGCWC 1 cut(s) 8
BsiHKCI CYCGRG 1 cut(s) 222
BsiSI CCGG 2 cut(s) 257, 333
BslI CCNNNNNNNGG 2 cut(s) 130, 346
BsmAI GTCTC 1 cut(s) 140
BsnI GGCC 2 cut(s) 32, 332
Bso31I GGTCTC 1 cut(s) 140
BsoBI CYCGRG 1 cut(s) 222
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 356
Bsp19I CCATGG 1 cut(s) 16
BspACI CCGC 3 cut(s) 26, 278, 321
BspANI GGCC 2 cut(s) 32, 332
BspCNI CTCAG 1 cut(s) 136
BspMI ACCTGC 1 cut(s) 67
BspTNI GGTCTC 1 cut(s) 140
BsrFI RCCGGY 1 cut(s) 332
BssAI RCCGGY 1 cut(s) 332
BssECI CCNNGG 1 cut(s) 16
BssMI GATC 1 cut(s) 356
BssNAI GTATAC 1 cut(s) 268
BssT1I CCWWGG 1 cut(s) 16
Bst1107I GTATAC 1 cut(s) 268
Bst2UI CCWGG 1 cut(s) 155
Bst4CI ACNGT 3 cut(s) 98, 234, 272
BstDEI CTNAG 1 cut(s) 144
BstDSI CCRYGG 1 cut(s) 16
BstEII GGTNACC 1 cut(s) 335
BstKTI GATC 1 cut(s) 359
BstMAI GTCTC 1 cut(s) 140
BstMBI GATC 1 cut(s) 356
BstMWI GCNNNNNNNGC 4 cut(s) 38, 82, 107, 329
BstNI CCWGG 1 cut(s) 155
BstPI GGTNACC 1 cut(s) 335
BstSCI CCNGG 2 cut(s) 153, 255
BstSFI CTRYAG 1 cut(s) 34
BstV2I GAAGAC 1 cut(s) 306
BstX2I RGATCY 1 cut(s) 356
BstYI RGATCY 1 cut(s) 356
BstZ17I GTATAC 1 cut(s) 268
BsuRI GGCC 2 cut(s) 32, 332
BtgI CCRYGG 1 cut(s) 16
BveI ACCTGC 1 cut(s) 67
Cfr10I RCCGGY 1 cut(s) 332
CseI GACGC 1 cut(s) 178
Csp6I GTAC 1 cut(s) 273
CviAII CATG 1 cut(s) 17
CviJI RGCY 9 cut(s) 11, 32, 41, 85, 110, 171, 220, 248, 332
CviKI_1 RGCY 9 cut(s) 11, 32, 41, 85, 110, 171, 220, 248, 332
CviQI GTAC 1 cut(s) 273
DdeI CTNAG 1 cut(s) 144
DpnI GATC 1 cut(s) 358
DpnII GATC 1 cut(s) 356
Eco130I CCWWGG 1 cut(s) 16
Eco147I AGGCCT 1 cut(s) 32
Eco31I GGTCTC 1 cut(s) 140
Eco88I CYCGRG 1 cut(s) 222
Eco91I GGTNACC 1 cut(s) 335
EcoO65I GGTNACC 1 cut(s) 335
EcoRII CCWGG 1 cut(s) 153
EcoT14I CCWWGG 1 cut(s) 16
ErhI CCWWGG 1 cut(s) 16
FaeI CATG 1 cut(s) 20
FaiI YATR 2 cut(s) 18, 268
FatI CATG 1 cut(s) 16
FblI GTMKAC 1 cut(s) 267
FspBI CTAG 2 cut(s) 107, 367
GsaI CCCAGC 1 cut(s) 189
HaeIII GGCC 2 cut(s) 32, 332
HapII CCGG 2 cut(s) 257, 333
HgaI GACGC 1 cut(s) 178
Hin1II CATG 1 cut(s) 20
HpaII CCGG 2 cut(s) 257, 333
HphI GGTGA 1 cut(s) 347
Hpy166II GTNNAC 1 cut(s) 268
Hpy188I TCNGA 1 cut(s) 145
Hpy8I GTNNAC 1 cut(s) 268
Hpy99I CGWCG 2 cut(s) 194, 197
HpyCH4III ACNGT 3 cut(s) 98, 234, 272
HpyCH4IV ACGT 1 cut(s) 174
HpyCH4V TGCA 1 cut(s) 315
HpyF10VI GCNNNNNNNGC 4 cut(s) 38, 82, 107, 329
HpyF3I CTNAG 1 cut(s) 144
HpySE526I ACGT 1 cut(s) 174
Hsp92II CATG 1 cut(s) 20
Kzo9I GATC 1 cut(s) 356
LmnI GCTCC 1 cut(s) 82
MaeI CTAG 2 cut(s) 107, 367
MaeII ACGT 1 cut(s) 174
MaeIII GTNAC 2 cut(s) 175, 335
MalI GATC 1 cut(s) 358
MboI GATC 1 cut(s) 356
MboII GAAGA 2 cut(s) 311, 317
MflI RGATCY 1 cut(s) 356
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 1 cut(s) 351
MmeI TCCRAC 1 cut(s) 50
MnlI CCTC 5 cut(s) 22, 127, 161, 209, 231
MseI TTAA 2 cut(s) 120, 159
MspI CCGG 2 cut(s) 257, 333
MspR9I CCNGG 2 cut(s) 155, 257
MvaI CCWGG 1 cut(s) 155
MwoI GCNNNNNNNGC 4 cut(s) 38, 82, 107, 329
NciI CCSGG 1 cut(s) 257
NcoI CCATGG 1 cut(s) 16
NdeII GATC 1 cut(s) 356
NlaIII CATG 1 cut(s) 20
NmuCI GTSAC 2 cut(s) 175, 335
PaeR7I CTCGAG 1 cut(s) 222
PaqCI CACCTGC 1 cut(s) 67
PceI AGGCCT 1 cut(s) 32
PflMI CCANNNNNTGG 2 cut(s) 130, 346
Psp6I CCWGG 1 cut(s) 153
PspEI GGTNACC 1 cut(s) 335
PspFI CCCAGC 1 cut(s) 185
PspGI CCWGG 1 cut(s) 153
PspXI VCTCGAGB 1 cut(s) 222
PsuI RGATCY 1 cut(s) 356
RsaI GTAC 1 cut(s) 274
RsaNI GTAC 1 cut(s) 273
SaqAI TTAA 2 cut(s) 120, 159
Sau3AI GATC 1 cut(s) 356
ScrFI CCNGG 2 cut(s) 155, 257
SduI GDGCHC 1 cut(s) 8
SetI ASST 6 cut(s) 81, 87, 112, 177, 313, 368
SfcI CTRYAG 1 cut(s) 34
Sfr274I CTCGAG 1 cut(s) 222
SlaI CTCGAG 1 cut(s) 222
SmlI CTYRAG 1 cut(s) 222
SmoI CTYRAG 1 cut(s) 222
Sse9I AATT 1 cut(s) 351
SseBI AGGCCT 1 cut(s) 32
SsiI CCGC 3 cut(s) 26, 278, 321
SspMI CTAG 2 cut(s) 107, 367
StuI AGGCCT 1 cut(s) 32
StyD4I CCNGG 2 cut(s) 153, 255
StyI CCWWGG 1 cut(s) 16
TaaI ACNGT 3 cut(s) 98, 234, 272
TaiI ACGT 1 cut(s) 177
TaqI TCGA 2 cut(s) 211, 223
TasI AATT 1 cut(s) 351
Tru1I TTAA 2 cut(s) 120, 159
Tru9I TTAA 2 cut(s) 120, 159
TseFI GTSAC 2 cut(s) 175, 335
Tsp45I GTSAC 2 cut(s) 175, 335
Van91I CCANNNNNTGG 2 cut(s) 130, 346
XhoI CTCGAG 1 cut(s) 222
XmiI GTMKAC 1 cut(s) 267
XspI CTAG 2 cut(s) 107, 367
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.