Rmu_sc0001522.1_g000014

Purple acid phosphatase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001522.1
OG0025511
Physical Location & Seq
Forward (+)
48330 .. 48668
339 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 339 bp
atgggttcttccggcacttgtggggttcccaaacttatctgtgttgtgttcgtgatattgtttcttggctcctgtgcttcttcatcatcttccttgcaccctttggttgtccagtcacagattgaacaccttaaccacacggcaatatcagagtttaggttgctgaacagaaaatttcttggcaactgtccgaatccgagcccatatctgcaaattagtgttaactcgagtccaggtggccttggagatgatgagtttgtgactgtcaatgttagtggcatcttgaacccttctaaaaatgattgggtggccatgatttcacctgctaattctgagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0003993 GO:0006793 GO:0006796 GO:0008150 GO:0008152 GO:0009987 GO:0016311 GO:0016787 GO:0016788 GO:0016791 GO:0042578 GO:0044237
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Metallophos Metallophos_C Pur_ac_phosph_N

Protein Analysis

112

Amino Acids

11.85

Weight (kDa)

5.82

Isoelectric Point (pI)

56.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025511)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8223780.1_g000001 Rmu_sc0001522.1_g000014
rosa_samantha Rh1DG028600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 331
Acc36I ACCTGC 1 cut(s) 331
AcoI YGGCCR 1 cut(s) 309
AcsI RAATTY 1 cut(s) 173
AgsI TTSAA 2 cut(s) 125, 286
AjnI CCWGG 1 cut(s) 232
Ama87I CYCGRG 1 cut(s) 226
AoxI GGCC 2 cut(s) 238, 309
ApoI RAATTY 1 cut(s) 173
AsuHPI GGTGA 1 cut(s) 312
AvaI CYCGRG 1 cut(s) 226
BalI TGGCCA 1 cut(s) 311
BanII GRGCYC 1 cut(s) 203
BceAI ACGGC 1 cut(s) 156
BciT130I CCWGG 1 cut(s) 234
BfuAI ACCTGC 1 cut(s) 331
Bme1390I CCNGG 1 cut(s) 234
BmeT110I CYCGRG 1 cut(s) 226
BmiI GGNNCC 2 cut(s) 27, 70
BmrFI CCNGG 1 cut(s) 234
BmsI GCATC 1 cut(s) 288
BsaJI CCNNGG 1 cut(s) 241
Bse1I ACTGG 1 cut(s) 112
BseBI CCWGG 1 cut(s) 234
BseDI CCNNGG 1 cut(s) 241
BseMII CTCAG 1 cut(s) 324
BseNI ACTGG 1 cut(s) 112
BshFI GGCC 2 cut(s) 240, 311
BsiHKCI CYCGRG 1 cut(s) 226
BsiSI CCGG 1 cut(s) 12
BsnI GGCC 2 cut(s) 240, 311
BsoBI CYCGRG 1 cut(s) 226
Bsp1286I GDGCHC 1 cut(s) 203
BspANI GGCC 2 cut(s) 240, 311
BspCNI CTCAG 1 cut(s) 325
BspLI GGNNCC 2 cut(s) 27, 70
BspMI ACCTGC 1 cut(s) 331
BsrI ACTGG 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 241
BssT1I CCWWGG 1 cut(s) 241
Bst2UI CCWGG 1 cut(s) 234
Bst4CI ACNGT 2 cut(s) 188, 265
BstDEI CTNAG 1 cut(s) 333
BstNI CCWGG 1 cut(s) 234
BstSCI CCNGG 1 cut(s) 232
BsuRI GGCC 2 cut(s) 240, 311
BveI ACCTGC 1 cut(s) 331
CspCI CAANNNNNGTGG 2 cut(s) 256, 291
CviAII CATG 1 cut(s) 313
CviJI RGCY 4 cut(s) 69, 201, 240, 311
CviKI_1 RGCY 4 cut(s) 69, 201, 240, 311
DdeI CTNAG 1 cut(s) 333
EaeI YGGCCR 1 cut(s) 309
Eco130I CCWWGG 1 cut(s) 241
Eco24I GRGCYC 1 cut(s) 203
Eco88I CYCGRG 1 cut(s) 226
EcoRII CCWGG 1 cut(s) 232
EcoT14I CCWWGG 1 cut(s) 241
EcoT38I GRGCYC 1 cut(s) 203
ErhI CCWWGG 1 cut(s) 241
FaeI CATG 1 cut(s) 316
FaiI YATR 2 cut(s) 205, 314
FatI CATG 1 cut(s) 312
FriOI GRGCYC 1 cut(s) 203
HaeIII GGCC 2 cut(s) 240, 311
HapII CCGG 1 cut(s) 12
Hin1II CATG 1 cut(s) 316
HincII GTYRAC 1 cut(s) 223
HindII GTYRAC 1 cut(s) 223
HinfI GANTC 2 cut(s) 193, 229
HpaI GTTAAC 1 cut(s) 223
HpaII CCGG 1 cut(s) 12
HphI GGTGA 1 cut(s) 312
Hpy166II GTNNAC 1 cut(s) 223
Hpy188I TCNGA 4 cut(s) 151, 192, 198, 334
Hpy188III TCNNGA 2 cut(s) 52, 283
Hpy8I GTNNAC 1 cut(s) 223
HpyAV CCTTC 1 cut(s) 300
HpyCH4III ACNGT 2 cut(s) 188, 265
HpyCH4V TGCA 2 cut(s) 97, 211
HpyF3I CTNAG 1 cut(s) 333
Hsp92II CATG 1 cut(s) 316
KspAI GTTAAC 1 cut(s) 223
LmnI GCTCC 1 cut(s) 74
LpnPI CCDG 5 cut(s) 25, 85, 125, 219, 246
LweI GCATC 1 cut(s) 288
MaeIII GTNAC 2 cut(s) 114, 259
MboII GAAGA 2 cut(s) 72, 81
MhlI GDGCHC 1 cut(s) 203
MlsI TGGCCA 1 cut(s) 311
MluCI AATT 3 cut(s) 173, 213, 328
MluNI TGGCCA 1 cut(s) 311
MlyI GAGTC 1 cut(s) 238
Mox20I TGGCCA 1 cut(s) 311
MscI TGGCCA 1 cut(s) 311
MseI TTAA 2 cut(s) 132, 222
Msp20I TGGCCA 1 cut(s) 311
MspI CCGG 1 cut(s) 12
MspR9I CCNGG 1 cut(s) 234
MvaI CCWGG 1 cut(s) 234
NlaIII CATG 1 cut(s) 316
NlaIV GGNNCC 2 cut(s) 27, 70
NmuCI GTSAC 2 cut(s) 114, 259
PaeR7I CTCGAG 1 cut(s) 226
PaqCI CACCTGC 1 cut(s) 331
PfeI GAWTC 1 cut(s) 193
PleI GAGTC 1 cut(s) 237
PpsI GAGTC 1 cut(s) 237
Psp6I CCWGG 1 cut(s) 232
PspGI CCWGG 1 cut(s) 232
PspN4I GGNNCC 2 cut(s) 27, 70
PspXI VCTCGAGB 1 cut(s) 226
SaqAI TTAA 2 cut(s) 132, 222
SchI GAGTC 1 cut(s) 238
ScrFI CCNGG 1 cut(s) 234
SduI GDGCHC 1 cut(s) 203
SetI ASST 4 cut(s) 132, 161, 238, 325
SfaNI GCATC 1 cut(s) 288
Sfr274I CTCGAG 1 cut(s) 226
SlaI CTCGAG 1 cut(s) 226
SmlI CTYRAG 1 cut(s) 226
SmoI CTYRAG 1 cut(s) 226
Sse9I AATT 3 cut(s) 173, 213, 328
StyD4I CCNGG 1 cut(s) 232
StyI CCWWGG 1 cut(s) 241
TaaI ACNGT 2 cut(s) 188, 265
TaqI TCGA 1 cut(s) 227
TasI AATT 3 cut(s) 173, 213, 328
TfiI GAWTC 1 cut(s) 193
Tru1I TTAA 2 cut(s) 132, 222
Tru9I TTAA 2 cut(s) 132, 222
TseFI GTSAC 2 cut(s) 114, 259
Tsp45I GTSAC 2 cut(s) 114, 259
TspDTI ATGAA 1 cut(s) 72
XapI RAATTY 1 cut(s) 173
XhoI CTCGAG 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.