Rmu_sc0001621.1_g000001
ERF Family

P-loop nucleoside triphosphate hydrolase superfamily protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001621.1
OG0031145
Physical Location & Seq
Reverse (-)
2170 .. 2512
343 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 246 bp
atgggtggaagttcgattgatgatgactgggagcttcccttttctaatgctgctcgcactgtggtcttggttagtcgcactggtaatggaaaaagcgcaacaggcaacagcattcttggcaaaaaagcatgcactgtgctgtggattctggtgttgttgaaaccaacatcatgcgagaagttcctccatgccttccagtttggctttcaaagttttgagacttctgtgcctcttgcagtcaactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AIG1

Protein Analysis

81

Amino Acids

8.71

Weight (kDa)

7.81

Isoelectric Point (pI)

38.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AIG1 PF04548 19 - 43 2.3e-08 AIG1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031145)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001621.1_g000001
rosa_samantha Rh7DG405200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 160, 209
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
Alw26I GTCTC 1 cut(s) 212
ApeKI GCWGC 1 cut(s) 50
AspLEI GCGC 1 cut(s) 98
BbvI GCAGC 1 cut(s) 37
BcoDI GTCTC 1 cut(s) 212
BisI GCNGC 1 cut(s) 51
BlsI GCNGC 1 cut(s) 52
BmrI ACTGGG 1 cut(s) 37
BmuI ACTGGG 1 cut(s) 37
Bse1I ACTGG 3 cut(s) 32, 85, 196
BseNI ACTGG 3 cut(s) 32, 85, 196
BseXI GCAGC 1 cut(s) 37
BsmAI GTCTC 1 cut(s) 212
BsmI GAATGC 1 cut(s) 111
BsrI ACTGG 3 cut(s) 32, 85, 196
Bst4CI ACNGT 2 cut(s) 61, 136
BstC8I GCNNGC 2 cut(s) 55, 130
BstHHI GCGC 1 cut(s) 98
BstMAI GTCTC 1 cut(s) 212
BstMWI GCNNNNNNNGC 2 cut(s) 102, 117
BstNSI RCATGY 1 cut(s) 132
BstV1I GCAGC 1 cut(s) 37
BtsIMutI CAGTG 3 cut(s) 57, 78, 132
Cac8I GCNNGC 2 cut(s) 55, 130
CfoI GCGC 1 cut(s) 98
CviAII CATG 3 cut(s) 129, 171, 188
CviJI RGCY 2 cut(s) 34, 204
CviKI_1 RGCY 2 cut(s) 34, 204
FaeI CATG 3 cut(s) 132, 174, 191
FaiI YATR 3 cut(s) 130, 172, 189
FatI CATG 3 cut(s) 128, 170, 187
Fnu4HI GCNGC 1 cut(s) 51
Fsp4HI GCNGC 1 cut(s) 51
GlaI GCGC 1 cut(s) 97
GluI GCNGC 1 cut(s) 51
HhaI GCGC 1 cut(s) 98
Hin1II CATG 3 cut(s) 132, 174, 191
Hin6I GCGC 1 cut(s) 96
HinP1I GCGC 1 cut(s) 96
HincII GTYRAC 1 cut(s) 241
HindII GTYRAC 1 cut(s) 241
HinfI GANTC 1 cut(s) 145
Hpy166II GTNNAC 1 cut(s) 241
Hpy8I GTNNAC 1 cut(s) 241
HpyAV CCTTC 1 cut(s) 202
HpyCH4III ACNGT 2 cut(s) 61, 136
HpyCH4V TGCA 2 cut(s) 132, 236
HpyF10VI GCNNNNNNNGC 2 cut(s) 102, 117
Hsp92II CATG 3 cut(s) 132, 174, 191
HspAI GCGC 1 cut(s) 96
LmnI GCTCC 1 cut(s) 31
LpnPI CCDG 5 cut(s) 13, 66, 87, 134, 209
Lsp1109I GCAGC 1 cut(s) 37
MnlI CCTC 2 cut(s) 194, 240
Mva1269I GAATGC 1 cut(s) 111
MwoI GCNNNNNNNGC 2 cut(s) 102, 117
NlaIII CATG 3 cut(s) 132, 174, 191
NspI RCATGY 1 cut(s) 132
PaeI GCATGC 1 cut(s) 132
PctI GAATGC 1 cut(s) 111
PfeI GAWTC 1 cut(s) 145
PkrI GCNGC 1 cut(s) 52
SatI GCNGC 1 cut(s) 51
SetI ASST 1 cut(s) 36
SphI GCATGC 1 cut(s) 132
TaaI ACNGT 2 cut(s) 61, 136
TaqI TCGA 1 cut(s) 14
TfiI GAWTC 1 cut(s) 145
TscAI CASTG 3 cut(s) 64, 85, 139
TseI GCWGC 1 cut(s) 50
TspRI CASTG 3 cut(s) 64, 85, 139
XceI RCATGY 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.