Rmu_sc0001909.1_g000014

Protein LST8 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001909.1
OG0031168
Physical Location & Seq
Reverse (-)
60168 .. 61334
1167 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 414 bp
atggtttataattttagatatctggccactgcctcttctgaccacattgtcaagatatggaatgttgatggtttcacattagagaaagctctagaaggggaaagcagagatgatctcataacatatggggaaggaggagatggagttcttgatgactggatagcaggtcgacgaggatgtattgatcgatttctggaaggctgtgtctttgaatgctttctaggagataaccgtaataggcttgaaagtgctgtaggtttaactaaaggctttataaccttagaaaccttttcagttgatgatcacaatggacatgcaggtgttgtaggtttatctaaaggctttacaagcctagaaaccttttcaacagatgttcgcaagtggtttggtggaagtgctgtgattcgcaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0001932 GO:0001934 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005776 GO:0006935 GO:0006950 GO:0007154 GO:0007165 GO:0007190 GO:0008064 GO:0008150 GO:0009267 GO:0009605 GO:0009893 GO:0009987 GO:0009991 GO:0010562 GO:0010604 GO:0010638 GO:0016043 GO:0019220 GO:0019222 GO:0023052 GO:0030100 GO:0030587 GO:0030832 GO:0030833 GO:0030838 GO:0031152 GO:0031252 GO:0031323 GO:0031325 GO:0031334 GO:0031399 GO:0031401 GO:0031667 GO:0031668 GO:0031669 GO:0031929 GO:0031931 GO:0031932 GO:0032147 GO:0032148 GO:0032268 GO:0032270 GO:0032271 GO:0032273 GO:0032502 GO:0032535 GO:0032879 GO:0032956 GO:0032970 GO:0032991 GO:0033043 GO:0033554 GO:0033674 GO:0035556 GO:0038201 GO:0040011 GO:0042221 GO:0042325 GO:0042327 GO:0042330 GO:0042594 GO:0043085 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043254 GO:0043327 GO:0043519 GO:0043520 GO:0043549 GO:0044087 GO:0044089 GO:0044093 GO:0044424 GO:0044444 GO:0044464 GO:0044764 GO:0045806 GO:0045859 GO:0045860 GO:0045937 GO:0048518 GO:0048519 GO:0048522 GO:0048523 GO:0048856 GO:0050764 GO:0050765 GO:0050789 GO:0050790 GO:0050794 GO:0050896 GO:0051049 GO:0051051 GO:0051128 GO:0051129 GO:0051130 GO:0051171 GO:0051173 GO:0051174 GO:0051246 GO:0051247 GO:0051338 GO:0051347 GO:0051493 GO:0051495 GO:0051703 GO:0051704 GO:0051716 GO:0060255 GO:0060627 GO:0065007 GO:0065008 GO:0065009 GO:0071496 GO:0071840 GO:0080090 GO:0090066 GO:0090702 GO:0098630 GO:0098743 GO:0099120 GO:0110053 GO:1902903 GO:1902905
KEGG Pathways
Metabolic & Signaling
ko04136 ko04138 ko04140 ko04150 ko04151 ko04714 map04136 map04138 map04140 map04150 map04151 map04714
Pfam Domains
Protein Families
WD40

Protein Analysis

137

Amino Acids

15.12

Weight (kDa)

4.85

Isoelectric Point (pI)

21.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031168)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001909.1_g000014
rosa_roxburghii Rroxscaffold_4G00306330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 9, 275
AarI CACCTGC 1 cut(s) 308
AasI GACNNNNNNGTC 1 cut(s) 47
Acc36I ACCTGC 2 cut(s) 155, 308
AccI GTMKAC 1 cut(s) 169
AcoI YGGCCR 1 cut(s) 24
AgsI TTSAA 3 cut(s) 212, 245, 366
AloI GAACNNNNNNTCC 2 cut(s) 129, 161
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
AoxI GGCC 1 cut(s) 24
Asp700I GAANNNNTTC 1 cut(s) 216
BalI TGGCCA 1 cut(s) 26
BccI CCATC 2 cut(s) 62, 134
BclI TGATCA 1 cut(s) 301
BfaI CTAG 3 cut(s) 92, 221, 353
BfmI CTRYAG 1 cut(s) 252
BfuAI ACCTGC 2 cut(s) 155, 308
BplI GAGNNNNNCTC 2 cut(s) 99, 131
Bsa29I ATCGAT 1 cut(s) 187
BsaXI ACNNNNNCTCC 2 cut(s) 129, 159
Bse1I ACTGG 1 cut(s) 161
BseCI ATCGAT 1 cut(s) 187
BseGI GGATG 1 cut(s) 182
BseNI ACTGG 1 cut(s) 161
BseRI GAGGAG 1 cut(s) 150
BshFI GGCC 1 cut(s) 26
BshVI ATCGAT 1 cut(s) 187
BsmI GAATGC 1 cut(s) 218
BsnI GGCC 1 cut(s) 26
Bsp143I GATC 3 cut(s) 112, 184, 301
BspANI GGCC 1 cut(s) 26
BspDI ATCGAT 1 cut(s) 187
BspMI ACCTGC 2 cut(s) 155, 308
BsrI ACTGG 1 cut(s) 161
BssMI GATC 3 cut(s) 112, 184, 301
Bst4CI ACNGT 1 cut(s) 233
Bst6I CTCTTC 1 cut(s) 40
BstDEI CTNAG 1 cut(s) 280
BstF5I GGATG 1 cut(s) 182
BstKTI GATC 3 cut(s) 115, 187, 304
BstMBI GATC 3 cut(s) 112, 184, 301
BstMWI GCNNNNNNNGC 1 cut(s) 348
BstNSI RCATGY 1 cut(s) 317
BstSFI CTRYAG 1 cut(s) 252
Bsu15I ATCGAT 1 cut(s) 187
BsuRI GGCC 1 cut(s) 26
BsuTUI ATCGAT 1 cut(s) 187
BtsCI GGATG 1 cut(s) 182
BtsI GCAGTG 1 cut(s) 27
BtsIMutI CAGTG 1 cut(s) 27
BveI ACCTGC 2 cut(s) 155, 308
ClaI ATCGAT 1 cut(s) 187
CviAII CATG 1 cut(s) 314
CviJI RGCY 7 cut(s) 26, 89, 201, 241, 270, 342, 351
CviKI_1 RGCY 7 cut(s) 26, 89, 201, 241, 270, 342, 351
DdeI CTNAG 1 cut(s) 280
DpnI GATC 3 cut(s) 114, 186, 303
DpnII GATC 3 cut(s) 112, 184, 301
DrdI GACNNNNNNGTC 1 cut(s) 47
DseDI GACNNNNNNGTC 1 cut(s) 47
EaeI YGGCCR 1 cut(s) 24
Eam1104I CTCTTC 1 cut(s) 40
EarI CTCTTC 1 cut(s) 40
Eco32I GATATC 1 cut(s) 20
EcoRV GATATC 1 cut(s) 20
FaeI CATG 1 cut(s) 317
FaiI YATR 7 cut(s) 9, 58, 119, 124, 126, 275, 315
FatI CATG 1 cut(s) 313
FauNDI CATATG 1 cut(s) 124
FbaI TGATCA 1 cut(s) 301
FblI GTMKAC 1 cut(s) 169
FokI GGATG 1 cut(s) 189
FspBI CTAG 3 cut(s) 92, 221, 353
HaeIII GGCC 1 cut(s) 26
Hin1II CATG 1 cut(s) 317
HincII GTYRAC 1 cut(s) 170
HindII GTYRAC 1 cut(s) 170
HinfI GANTC 1 cut(s) 403
Hpy166II GTNNAC 1 cut(s) 170
Hpy188I TCNGA 1 cut(s) 40
Hpy188III TCNNGA 4 cut(s) 52, 92, 149, 194
Hpy8I GTNNAC 1 cut(s) 170
Hpy99I CGWCG 1 cut(s) 174
HpyAV CCTTC 3 cut(s) 89, 125, 191
HpyCH4III ACNGT 1 cut(s) 233
HpyCH4V TGCA 1 cut(s) 317
HpyF10VI GCNNNNNNNGC 1 cut(s) 348
HpyF3I CTNAG 1 cut(s) 280
Hsp92II CATG 1 cut(s) 317
Ksp22I TGATCA 1 cut(s) 301
Kzo9I GATC 3 cut(s) 112, 184, 301
LpnPI CCDG 5 cut(s) 8, 142, 150, 179, 303
MaeI CTAG 3 cut(s) 92, 221, 353
MalI GATC 3 cut(s) 114, 186, 303
MboI GATC 3 cut(s) 112, 184, 301
MboII GAAGA 1 cut(s) 27
MfeI CAATTG 1 cut(s) 409
MlsI TGGCCA 1 cut(s) 26
MluCI AATT 2 cut(s) 10, 409
MluNI TGGCCA 1 cut(s) 26
MnlI CCTC 3 cut(s) 43, 128, 167
Mox20I TGGCCA 1 cut(s) 26
MroXI GAANNNNTTC 1 cut(s) 216
MscI TGGCCA 1 cut(s) 26
MseI TTAA 1 cut(s) 260
MslI CAYNNNNRTG 1 cut(s) 318
Msp20I TGGCCA 1 cut(s) 26
MunI CAATTG 1 cut(s) 409
Mva1269I GAATGC 1 cut(s) 218
MwoI GCNNNNNNNGC 1 cut(s) 348
NdeI CATATG 1 cut(s) 124
NdeII GATC 3 cut(s) 112, 184, 301
NlaIII CATG 1 cut(s) 317
NspI RCATGY 1 cut(s) 317
PaqCI CACCTGC 1 cut(s) 308
PctI GAATGC 1 cut(s) 218
PdmI GAANNNNTTC 1 cut(s) 216
PfeI GAWTC 1 cut(s) 403
PsiI TTATAA 2 cut(s) 9, 275
RseI CAYNNNNRTG 1 cut(s) 318
SalI GTCGAC 1 cut(s) 168
SaqAI TTAA 1 cut(s) 260
Sau3AI GATC 3 cut(s) 112, 184, 301
SetI ASST 8 cut(s) 91, 169, 259, 281, 290, 322, 331, 362
SfcI CTRYAG 1 cut(s) 252
SmiMI CAYNNNNRTG 1 cut(s) 318
Sse9I AATT 2 cut(s) 10, 409
SspMI CTAG 3 cut(s) 92, 221, 353
TaaI ACNGT 1 cut(s) 233
TaqI TCGA 2 cut(s) 169, 187
TasI AATT 2 cut(s) 10, 409
TfiI GAWTC 1 cut(s) 403
Tru1I TTAA 1 cut(s) 260
Tru9I TTAA 1 cut(s) 260
TscAI CASTG 1 cut(s) 34
TspRI CASTG 1 cut(s) 34
XbaI TCTAGA 1 cut(s) 91
XceI RCATGY 1 cut(s) 317
XmiI GTMKAC 1 cut(s) 169
XmnI GAANNNNTTC 1 cut(s) 216
XspI CTAG 3 cut(s) 92, 221, 353
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.