Rmu_sc0002009.1_g000004

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002009.1
Physical Location & Seq
Reverse (-)
16573 .. 17184
612 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002009.1_g000004.1.cds

Sequence Viewer

Length: 612 bp
atgcgggtgctacatctcaggaggtcgcctcttgatgagctaccaagtttcattggtagtttgtttcatctgagatttctcagcttgttttctaataggaagataaaaaggcttcccaattccatcagtaagctgctgaatttggagtacttgaaccttgacggttgcaacgcacttgaggaaatacccaaagacataggcaacctgatcaacctacgaagcttgacgataactacacagcagacgtatttgccaaaaggaattaggcacctcaccttacttcaatttttagaatttcgtggatgtgtcaatcttaaatctttgggcgaagagatccaattcctcaacaaccttcgcagtttgtggattggtagttgtaataatttggtatccttgccaccaaatatgaaacacgcgactgctttagatagttttggtgtcaatgattgcgtcaagcttcaggggatgatgagatcaggggaaggtcctcaacgtcttcgatcattgaagacggggattcaagtttggaggctttgcccccttggctcattgaagattctcactatgccagaaaagcaatcagacgacagaggagatctgtcgtctgattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

203

Amino Acids

23.0

Weight (kDa)

9.5

Isoelectric Point (pI)

51.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031178)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002009.1_g000004
rosa_wichuraiana Rw0G008850

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 267
AccII CGCG 1 cut(s) 416
AciI CCGC 1 cut(s) 4
AclWI GGATC 1 cut(s) 328
AcsI RAATTY 2 cut(s) 139, 293
AcuI CTGAAG 1 cut(s) 443
AfaI GTAC 1 cut(s) 149
AgsI TTSAA 5 cut(s) 154, 284, 508, 521, 553
AluBI AGCT 5 cut(s) 40, 84, 133, 222, 457
AluI AGCT 5 cut(s) 40, 84, 133, 222, 457
AlwI GGATC 1 cut(s) 328
ApeKI GCWGC 1 cut(s) 133
ApoI RAATTY 2 cut(s) 139, 293
AspS9I GGNCC 1 cut(s) 485
AsuHPI GGTGA 1 cut(s) 265
AvaII GGWCC 1 cut(s) 485
BanI GGYRCC 1 cut(s) 267
BbsI GAAGAC 2 cut(s) 488, 515
BbvI GCAGC 1 cut(s) 120
BccI CCATC 1 cut(s) 131
BciVI GTATCC 1 cut(s) 400
BclI TGATCA 1 cut(s) 207
BfuI GTATCC 1 cut(s) 400
BglI GCCNNNNNGGC 1 cut(s) 543
BglII AGATCT 1 cut(s) 595
BisI GCNGC 1 cut(s) 134
BlsI GCNGC 1 cut(s) 135
BmcAI AGTACT 1 cut(s) 149
Bme18I GGWCC 1 cut(s) 485
BmgT120I GGNCC 1 cut(s) 485
BmiI GGNNCC 1 cut(s) 269
BpiI GAAGAC 2 cut(s) 488, 515
BplI GAGNNNNNCTC 2 cut(s) 13, 45
BpuEI CTTGAG 1 cut(s) 197
BsaJI CCNNGG 1 cut(s) 541
BseDI CCNNGG 1 cut(s) 541
BseGI GGATG 2 cut(s) 308, 471
BseMII CTCAG 3 cut(s) 31, 62, 94
BseRI GAGGAG 1 cut(s) 606
BseXI GCAGC 1 cut(s) 120
Bsh1236I CGCG 1 cut(s) 416
BshNI GGYRCC 1 cut(s) 267
Bsp143I GATC 5 cut(s) 207, 333, 473, 500, 595
BspACI CCGC 1 cut(s) 4
BspCNI CTCAG 3 cut(s) 30, 63, 93
BspFNI CGCG 1 cut(s) 416
BspLI GGNNCC 1 cut(s) 269
BspPI GGATC 1 cut(s) 328
BspT107I GGYRCC 1 cut(s) 267
BssECI CCNNGG 1 cut(s) 541
BssMI GATC 5 cut(s) 207, 333, 473, 500, 595
BssT1I CCWWGG 1 cut(s) 541
Bst4CI ACNGT 1 cut(s) 164
Bst6I CTCTTC 1 cut(s) 324
BstDEI CTNAG 3 cut(s) 17, 71, 80
BstF5I GGATG 2 cut(s) 308, 471
BstFNI CGCG 1 cut(s) 416
BstKTI GATC 5 cut(s) 210, 336, 476, 503, 598
BstMBI GATC 5 cut(s) 207, 333, 473, 500, 595
BstMWI GCNNNNNNNGC 2 cut(s) 543, 574
BstUI CGCG 1 cut(s) 416
BstV1I GCAGC 1 cut(s) 120
BstV2I GAAGAC 2 cut(s) 488, 515
BstX2I RGATCY 2 cut(s) 333, 595
BstYI RGATCY 2 cut(s) 333, 595
BsuI GTATCC 1 cut(s) 400
BtsCI GGATG 2 cut(s) 308, 471
Cfr13I GGNCC 1 cut(s) 485
CseI GACGC 1 cut(s) 439
Csp6I GTAC 1 cut(s) 148
CviJI RGCY 8 cut(s) 40, 84, 112, 133, 222, 457, 532, 546
CviKI_1 RGCY 8 cut(s) 40, 84, 112, 133, 222, 457, 532, 546
CviQI GTAC 1 cut(s) 148
DdeI CTNAG 3 cut(s) 17, 71, 80
DpnI GATC 5 cut(s) 209, 335, 475, 502, 597
DpnII GATC 5 cut(s) 207, 333, 473, 500, 595
Eam1104I CTCTTC 1 cut(s) 324
EarI CTCTTC 1 cut(s) 324
Eco130I CCWWGG 1 cut(s) 541
Eco47I GGWCC 1 cut(s) 485
Eco57I CTGAAG 1 cut(s) 443
EcoO109I RGGNCCY 1 cut(s) 485
EcoT14I CCWWGG 1 cut(s) 541
ErhI CCWWGG 1 cut(s) 541
FaiI YATR 3 cut(s) 197, 407, 566
FbaI TGATCA 1 cut(s) 207
Fnu4HI GCNGC 1 cut(s) 134
FokI GGATG 2 cut(s) 315, 478
Fsp4HI GCNGC 1 cut(s) 134
GluI GCNGC 1 cut(s) 134
HgaI GACGC 1 cut(s) 439
HindIII AAGCTT 2 cut(s) 220, 455
HinfI GANTC 2 cut(s) 517, 556
HphI GGTGA 1 cut(s) 265
Hpy188I TCNGA 3 cut(s) 72, 583, 607
Hpy188III TCNNGA 2 cut(s) 19, 32
HpyAV CCTTC 2 cut(s) 362, 476
HpyCH4III ACNGT 1 cut(s) 164
HpyCH4IV ACGT 2 cut(s) 245, 493
HpyCH4V TGCA 1 cut(s) 168
HpyF10VI GCNNNNNNNGC 2 cut(s) 543, 574
HpyF3I CTNAG 3 cut(s) 17, 71, 80
HpySE526I ACGT 2 cut(s) 245, 493
Ksp22I TGATCA 1 cut(s) 207
Kzo9I GATC 5 cut(s) 207, 333, 473, 500, 595
LpnPI CCDG 5 cut(s) 4, 218, 446, 462, 582
Lsp1109I GCAGC 1 cut(s) 120
MaeII ACGT 2 cut(s) 245, 493
MalI GATC 5 cut(s) 209, 335, 475, 502, 597
MboI GATC 5 cut(s) 207, 333, 473, 500, 595
MboII GAAGA 5 cut(s) 112, 341, 488, 520, 565
MflI RGATCY 2 cut(s) 333, 595
MluCI AATT 7 cut(s) 118, 139, 261, 284, 293, 338, 382
MnlI CCTC 8 cut(s) 15, 39, 172, 281, 353, 498, 522, 584
MseI TTAA 2 cut(s) 315, 610
MvnI CGCG 1 cut(s) 416
MwoI GCNNNNNNNGC 2 cut(s) 543, 574
NdeII GATC 5 cut(s) 207, 333, 473, 500, 595
NlaIV GGNNCC 1 cut(s) 269
PfeI GAWTC 2 cut(s) 517, 556
PkrI GCNGC 1 cut(s) 135
PpuMI RGGWCCY 1 cut(s) 485
Psp5II RGGWCCY 1 cut(s) 485
PspN4I GGNNCC 1 cut(s) 269
PspPI GGNCC 1 cut(s) 485
PspPPI RGGWCCY 1 cut(s) 485
PsuI RGATCY 2 cut(s) 333, 595
RsaI GTAC 1 cut(s) 149
RsaNI GTAC 1 cut(s) 148
SaqAI TTAA 2 cut(s) 315, 610
SatI GCNGC 1 cut(s) 134
Sau3AI GATC 5 cut(s) 207, 333, 473, 500, 595
Sau96I GGNCC 1 cut(s) 485
ScaI AGTACT 1 cut(s) 149
SinI GGWCC 1 cut(s) 485
SmlI CTYRAG 1 cut(s) 176
SmoI CTYRAG 1 cut(s) 176
Sse9I AATT 7 cut(s) 118, 139, 261, 284, 293, 338, 382
SsiI CCGC 1 cut(s) 4
StyI CCWWGG 1 cut(s) 541
TaaI ACNGT 1 cut(s) 164
TaiI ACGT 2 cut(s) 248, 496
TaqI TCGA 1 cut(s) 499
TasI AATT 7 cut(s) 118, 139, 261, 284, 293, 338, 382
TatI WGTACW 1 cut(s) 147
TfiI GAWTC 2 cut(s) 517, 556
Tru1I TTAA 2 cut(s) 315, 610
Tru9I TTAA 2 cut(s) 315, 610
TseI GCWGC 1 cut(s) 133
TspDTI ATGAA 3 cut(s) 40, 56, 422
VpaK11BI GGWCC 1 cut(s) 485
XapI RAATTY 2 cut(s) 139, 293
ZrmI AGTACT 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.