Rmu_sc0002083.1_g000026

Sieve element occlusion

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002083.1
OG0030034
Physical Location & Seq
Reverse (-)
122186 .. 122464
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002083.1_g000026.1.cds

Sequence Viewer

Length: 279 bp
atgctaggcctagcgcacaatgttgctaccaaggtagccacagtagtccacactactcagaaaaccattgcaggggagcttagtctgtttgccatgtctgacaagaagatcttggaggagatttacacgactcatgtccatgctgatgaattcttcgatgacgattctctattcgtcattgttgagaacatccttatattgaatattggctttattatattggtggacaaaatccaatttgaatggcccatggtgatcacgtgggcaaggcacccctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SEO_C SEO_N

Protein Analysis

92

Amino Acids

10.47

Weight (kDa)

5.1

Isoelectric Point (pI)

27.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030034)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0389851
rosa_multiflora Rmu_sc0002083.1_g000026

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 270
AcsI RAATTY 1 cut(s) 149
AcvI CACGTG 1 cut(s) 261
AfiI CCNNNNNNNGG 1 cut(s) 72
AgsI TTSAA 2 cut(s) 202, 242
AluBI AGCT 1 cut(s) 79
AluI AGCT 1 cut(s) 79
AoxI GGCC 2 cut(s) 7, 245
ApoI RAATTY 1 cut(s) 149
AspLEI GCGC 1 cut(s) 16
AspS9I GGNCC 1 cut(s) 246
AsuHPI GGTGA 1 cut(s) 265
BanI GGYRCC 1 cut(s) 270
BbrPI CACGTG 1 cut(s) 261
BclI TGATCA 1 cut(s) 255
BfaI CTAG 3 cut(s) 5, 11, 277
BglII AGATCT 1 cut(s) 108
BmgT120I GGNCC 1 cut(s) 246
BmiI GGNNCC 1 cut(s) 272
BoxI GACNNNNGTC 1 cut(s) 134
BsaAI YACGTR 1 cut(s) 261
BsaJI CCNNGG 2 cut(s) 30, 249
Bsc4I CCNNNNNNNGG 1 cut(s) 72
Bse3DI GCAATG 1 cut(s) 66
BseDI CCNNGG 2 cut(s) 30, 249
BseGI GGATG 1 cut(s) 189
BseLI CCNNNNNNNGG 1 cut(s) 72
BseMI GCAATG 1 cut(s) 66
BseMII CTCAG 1 cut(s) 71
BseRI GAGGAG 1 cut(s) 131
BshFI GGCC 2 cut(s) 9, 247
BshNI GGYRCC 1 cut(s) 270
BslI CCNNNNNNNGG 1 cut(s) 72
BsnI GGCC 2 cut(s) 9, 247
Bsp143I GATC 2 cut(s) 108, 255
Bsp19I CCATGG 1 cut(s) 249
BspANI GGCC 2 cut(s) 9, 247
BspCNI CTCAG 1 cut(s) 70
BspLI GGNNCC 1 cut(s) 272
BspT107I GGYRCC 1 cut(s) 270
BsrDI GCAATG 1 cut(s) 66
BssECI CCNNGG 2 cut(s) 30, 249
BssMI GATC 2 cut(s) 108, 255
BssT1I CCWWGG 2 cut(s) 30, 249
Bst4CI ACNGT 1 cut(s) 43
BstBAI YACGTR 1 cut(s) 261
BstDEI CTNAG 2 cut(s) 57, 80
BstDSI CCRYGG 1 cut(s) 249
BstF5I GGATG 1 cut(s) 189
BstHHI GCGC 1 cut(s) 16
BstKTI GATC 2 cut(s) 111, 258
BstMBI GATC 2 cut(s) 108, 255
BstPAI GACNNNNGTC 1 cut(s) 134
BstX2I RGATCY 1 cut(s) 108
BstYI RGATCY 1 cut(s) 108
BsuRI GGCC 2 cut(s) 9, 247
BtgI CCRYGG 1 cut(s) 249
BtsCI GGATG 1 cut(s) 189
CfoI GCGC 1 cut(s) 16
Cfr13I GGNCC 1 cut(s) 246
CviAII CATG 4 cut(s) 94, 134, 140, 250
CviJI RGCY 5 cut(s) 9, 38, 79, 210, 247
CviKI_1 RGCY 5 cut(s) 9, 38, 79, 210, 247
DdeI CTNAG 2 cut(s) 57, 80
DpnI GATC 2 cut(s) 110, 257
DpnII GATC 2 cut(s) 108, 255
Eco130I CCWWGG 2 cut(s) 30, 249
Eco147I AGGCCT 1 cut(s) 9
Eco72I CACGTG 1 cut(s) 261
EcoRI GAATTC 1 cut(s) 149
EcoT14I CCWWGG 2 cut(s) 30, 249
ErhI CCWWGG 2 cut(s) 30, 249
FaeI CATG 4 cut(s) 97, 137, 143, 253
FaiI YATR 6 cut(s) 95, 135, 141, 197, 218, 251
FalI AAGNNNNNCTT 2 cut(s) 95, 127
FatI CATG 4 cut(s) 93, 133, 139, 249
FbaI TGATCA 1 cut(s) 255
FokI GGATG 1 cut(s) 176
FspBI CTAG 3 cut(s) 5, 11, 277
GlaI GCGC 1 cut(s) 15
HaeIII GGCC 2 cut(s) 9, 247
HhaI GCGC 1 cut(s) 16
Hin1II CATG 4 cut(s) 97, 137, 143, 253
Hin6I GCGC 1 cut(s) 14
HinP1I GCGC 1 cut(s) 14
HinfI GANTC 2 cut(s) 130, 164
HphI GGTGA 1 cut(s) 265
Hpy166II GTNNAC 2 cut(s) 49, 226
Hpy188I TCNGA 2 cut(s) 60, 100
Hpy8I GTNNAC 2 cut(s) 49, 226
HpyCH4III ACNGT 1 cut(s) 43
HpyCH4IV ACGT 1 cut(s) 260
HpyCH4V TGCA 1 cut(s) 71
HpyF3I CTNAG 2 cut(s) 57, 80
HpySE526I ACGT 1 cut(s) 260
Hsp92II CATG 4 cut(s) 97, 137, 143, 253
HspAI GCGC 1 cut(s) 14
Ksp22I TGATCA 1 cut(s) 255
Kzo9I GATC 2 cut(s) 108, 255
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 1 cut(s) 57
MaeI CTAG 3 cut(s) 5, 11, 277
MaeII ACGT 1 cut(s) 260
MalI GATC 2 cut(s) 110, 257
MboI GATC 2 cut(s) 108, 255
MboII GAAGA 2 cut(s) 118, 145
MflI RGATCY 1 cut(s) 108
MluCI AATT 2 cut(s) 149, 236
MlyI GAGTC 1 cut(s) 124
MnlI CCTC 1 cut(s) 109
MslI CAYNNNNRTG 2 cut(s) 138, 144
NcoI CCATGG 1 cut(s) 249
NdeII GATC 2 cut(s) 108, 255
NlaIII CATG 4 cut(s) 97, 137, 143, 253
NlaIV GGNNCC 1 cut(s) 272
PceI AGGCCT 1 cut(s) 9
PfeI GAWTC 1 cut(s) 164
PleI GAGTC 1 cut(s) 124
PmaCI CACGTG 1 cut(s) 261
PmlI CACGTG 1 cut(s) 261
PpsI GAGTC 1 cut(s) 124
Ppu21I YACGTR 1 cut(s) 261
PshAI GACNNNNGTC 1 cut(s) 134
PspCI CACGTG 1 cut(s) 261
PspN4I GGNNCC 1 cut(s) 272
PspPI GGNCC 1 cut(s) 246
PsuI RGATCY 1 cut(s) 108
RseI CAYNNNNRTG 2 cut(s) 138, 144
Sau3AI GATC 2 cut(s) 108, 255
Sau96I GGNCC 1 cut(s) 246
SchI GAGTC 1 cut(s) 124
SetI ASST 3 cut(s) 36, 81, 263
SmiMI CAYNNNNRTG 2 cut(s) 138, 144
Sse9I AATT 2 cut(s) 149, 236
SseBI AGGCCT 1 cut(s) 9
SspI AATATT 1 cut(s) 205
SspMI CTAG 3 cut(s) 5, 11, 277
StuI AGGCCT 1 cut(s) 9
StyI CCWWGG 2 cut(s) 30, 249
TaaI ACNGT 1 cut(s) 43
TaiI ACGT 1 cut(s) 263
TaqI TCGA 1 cut(s) 156
TasI AATT 2 cut(s) 149, 236
TfiI GAWTC 1 cut(s) 164
TspDTI ATGAA 1 cut(s) 162
XapI RAATTY 1 cut(s) 149
XspI CTAG 3 cut(s) 5, 11, 277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.