Rmu_sc0002472.1_g000017

Cytochrome p450

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002472.1
Physical Location & Seq
Forward (+)
39442 .. 39873
432 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002472.1_g000017.1.cds

Sequence Viewer

Length: 345 bp
atgcatgtgtttgaagaatttagattgttgacttcagaagtgatttccaggacagcttttggcagcagctacttagaaggacaaaacatttttgaaatgttgatgaagttaagcgtcatagtattcagaaatattcctttcaagattaggtttcttggtatgagtaaggtttttagaaccagtgacgagattgaagcagacaagcttgagaaaggaatacgagactctataatggagattattaagaaaagagaagaaaaggaaaccaacagggaaaaagagagctttggcaatgattttcttggcttacttgtgaatgcacatcatgacaccaatgacaactag

Protein Analysis

114

Amino Acids

13.35

Weight (kDa)

5.65

Isoelectric Point (pI)

38.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030032)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0437481
rosa_multiflora Rmu_sc0002472.1_g000017

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 17
AcuI CTGAAG 1 cut(s) 18
AgsI TTSAA 4 cut(s) 14, 95, 142, 194
AjnI CCWGG 1 cut(s) 47
AluBI AGCT 4 cut(s) 56, 69, 205, 285
AluI AGCT 4 cut(s) 56, 69, 205, 285
Alw26I GTCTC 1 cut(s) 216
ApeKI GCWGC 2 cut(s) 63, 66
ApoI RAATTY 1 cut(s) 17
BbvI GCAGC 2 cut(s) 75, 78
BciT130I CCWGG 1 cut(s) 49
BcoDI GTCTC 1 cut(s) 216
BfaI CTAG 1 cut(s) 343
BisI GCNGC 2 cut(s) 64, 67
BlsI GCNGC 2 cut(s) 65, 68
Bme1390I CCNGG 1 cut(s) 49
BmrFI CCNGG 1 cut(s) 49
BpuEI CTTGAG 1 cut(s) 227
Bse1I ACTGG 1 cut(s) 180
Bse3DI GCAATG 1 cut(s) 298
BseBI CCWGG 1 cut(s) 49
BseMI GCAATG 1 cut(s) 298
BseNI ACTGG 1 cut(s) 180
BseXI GCAGC 2 cut(s) 75, 78
BsmAI GTCTC 1 cut(s) 216
BsmI GAATGC 1 cut(s) 322
BspHI TCATGA 1 cut(s) 325
BsrDI GCAATG 1 cut(s) 298
BsrI ACTGG 1 cut(s) 180
Bst2UI CCWGG 1 cut(s) 49
BstDEI CTNAG 1 cut(s) 73
BstMAI GTCTC 1 cut(s) 216
BstNI CCWGG 1 cut(s) 49
BstNSI RCATGY 1 cut(s) 8
BstSCI CCNGG 1 cut(s) 47
BstV1I GCAGC 2 cut(s) 75, 78
BtsIMutI CAGTG 1 cut(s) 187
CciI TCATGA 1 cut(s) 325
CseI GACGC 1 cut(s) 103
CviAII CATG 2 cut(s) 5, 326
CviJI RGCY 5 cut(s) 56, 69, 205, 285, 306
CviKI_1 RGCY 5 cut(s) 56, 69, 205, 285, 306
DdeI CTNAG 1 cut(s) 73
Eco57I CTGAAG 1 cut(s) 18
EcoRII CCWGG 1 cut(s) 47
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 2 cut(s) 8, 329
FaiI YATR 5 cut(s) 6, 119, 161, 230, 327
FatI CATG 2 cut(s) 4, 325
Fnu4HI GCNGC 2 cut(s) 64, 67
Fsp4HI GCNGC 2 cut(s) 64, 67
FspBI CTAG 1 cut(s) 343
GluI GCNGC 2 cut(s) 64, 67
HgaI GACGC 1 cut(s) 103
Hin1II CATG 2 cut(s) 8, 329
HincII GTYRAC 1 cut(s) 30
HindII GTYRAC 1 cut(s) 30
HindIII AAGCTT 1 cut(s) 203
HinfI GANTC 1 cut(s) 224
Hpy166II GTNNAC 1 cut(s) 30
Hpy188I TCNGA 2 cut(s) 37, 128
Hpy188III TCNNGA 2 cut(s) 142, 326
Hpy8I GTNNAC 1 cut(s) 30
HpyAV CCTTC 1 cut(s) 71
HpyCH4V TGCA 2 cut(s) 4, 320
HpyF3I CTNAG 1 cut(s) 73
Hsp92II CATG 2 cut(s) 8, 329
LpnPI CCDG 4 cut(s) 34, 61, 193, 256
Lsp1109I GCAGC 2 cut(s) 75, 78
MaeI CTAG 1 cut(s) 343
MaeIII GTNAC 1 cut(s) 182
MboII GAAGA 2 cut(s) 26, 266
MluCI AATT 1 cut(s) 17
MlyI GAGTC 1 cut(s) 218
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 110, 243
MspR9I CCNGG 1 cut(s) 49
Mva1269I GAATGC 1 cut(s) 322
MvaI CCWGG 1 cut(s) 49
NlaIII CATG 2 cut(s) 8, 329
NmuCI GTSAC 1 cut(s) 182
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 8
PagI TCATGA 1 cut(s) 325
PctI GAATGC 1 cut(s) 322
PfoI TCCNGGA 1 cut(s) 47
PkrI GCNGC 2 cut(s) 65, 68
PleI GAGTC 1 cut(s) 218
PpsI GAGTC 1 cut(s) 218
Psp6I CCWGG 1 cut(s) 47
PspGI CCWGG 1 cut(s) 47
SaqAI TTAA 2 cut(s) 110, 243
SatI GCNGC 2 cut(s) 64, 67
SchI GAGTC 1 cut(s) 218
ScrFI CCNGG 1 cut(s) 49
SetI ASST 6 cut(s) 58, 71, 152, 171, 207, 287
SmlI CTYRAG 1 cut(s) 206
SmoI CTYRAG 1 cut(s) 206
Sse9I AATT 1 cut(s) 17
SspI AATATT 1 cut(s) 133
SspMI CTAG 1 cut(s) 343
StyD4I CCNGG 1 cut(s) 47
TasI AATT 1 cut(s) 17
Tru1I TTAA 2 cut(s) 110, 243
Tru9I TTAA 2 cut(s) 110, 243
TscAI CASTG 1 cut(s) 187
TseFI GTSAC 1 cut(s) 182
TseI GCWGC 2 cut(s) 63, 66
Tsp45I GTSAC 1 cut(s) 182
TspDTI ATGAA 1 cut(s) 119
TspRI CASTG 1 cut(s) 187
XapI RAATTY 1 cut(s) 17
XceI RCATGY 1 cut(s) 8
XspI CTAG 1 cut(s) 343
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.