Rmu_sc0002669.1_g000001

F-actin-capping proteins bind in a Ca(2 )-independent manner to the fast growing ends of actin filaments (barbed end) thereby blocking the exchange of subunits at these ends. Unlike other capping proteins (such as gelsolin and severin), these proteins do not sever actin filaments

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002669.1
OG0021649
Physical Location & Seq
Forward (+)
1 .. 1102
1102 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 282 bp
tttgaggaggggaatgtgcagttagatgcaaaacatgaatgcaaagattcaacaatttttcagtcctctgaagattctgcaattaccataggcaacattataaggcaacatgaggcagaatacttggcatctcttgaggcatcctattcaaacttgcccgataccacttttaaggatcttcgtagaaagcttctagttactcgcaccctatttccatggcagaatactttacagtttatcttgacaagagatatcacaaaagaacttggcattggaaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04144 map04144
Pfam Domains
Protein Families
F-actin_cap_A

Protein Analysis

93

Amino Acids

10.66

Weight (kDa)

5.29

Isoelectric Point (pI)

47.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-actin_cap_A PF01267 1 - 83 7.6e-22 F-actin capping protein alpha subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021649)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002050.1_g000003 Rmu_sc0002669.1_g000001 Rmu_sc0002882.1_g000017 Rmu_sc0008565.1_g000017
rosa_samantha Rh1AG050100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 101
AclWI GGATC 1 cut(s) 183
AcuI CTGAAG 1 cut(s) 90
AgsI TTSAA 2 cut(s) 51, 150
AjuI GAANNNNNNNTTGG 1 cut(s) 255
AluBI AGCT 1 cut(s) 190
AluI AGCT 1 cut(s) 190
AlwI GGATC 1 cut(s) 183
BfaI CTAG 1 cut(s) 194
BmsI GCATC 3 cut(s) 16, 137, 149
BpuEI CTTGAG 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 215
BseDI CCNNGG 1 cut(s) 215
BseGI GGATG 1 cut(s) 140
BseRI GAGGAG 1 cut(s) 20
BsgI GTGCAG 1 cut(s) 38
BsmI GAATGC 1 cut(s) 44
Bsp143I GATC 1 cut(s) 175
Bsp19I CCATGG 1 cut(s) 215
BspPI GGATC 1 cut(s) 183
BssECI CCNNGG 1 cut(s) 215
BssMI GATC 1 cut(s) 175
BssT1I CCWWGG 1 cut(s) 215
Bst4CI ACNGT 1 cut(s) 234
BstDSI CCRYGG 1 cut(s) 215
BstF5I GGATG 1 cut(s) 140
BstKTI GATC 1 cut(s) 178
BstMBI GATC 1 cut(s) 175
BstX2I RGATCY 1 cut(s) 175
BstYI RGATCY 1 cut(s) 175
BtgI CCRYGG 1 cut(s) 215
BtsCI GGATG 1 cut(s) 140
CviAII CATG 3 cut(s) 35, 110, 216
CviJI RGCY 1 cut(s) 190
CviKI_1 RGCY 1 cut(s) 190
DpnI GATC 1 cut(s) 177
DpnII GATC 1 cut(s) 175
Eco130I CCWWGG 1 cut(s) 215
Eco32I GATATC 1 cut(s) 253
Eco57I CTGAAG 1 cut(s) 90
EcoRV GATATC 1 cut(s) 253
EcoT14I CCWWGG 1 cut(s) 215
ErhI CCWWGG 1 cut(s) 215
FaeI CATG 3 cut(s) 38, 113, 219
FaiI YATR 5 cut(s) 36, 89, 101, 111, 217
FatI CATG 3 cut(s) 34, 109, 215
FokI GGATG 1 cut(s) 127
FspBI CTAG 1 cut(s) 194
Hin1II CATG 3 cut(s) 38, 113, 219
HindIII AAGCTT 1 cut(s) 188
HinfI GANTC 2 cut(s) 47, 74
Hpy188I TCNGA 1 cut(s) 70
Hpy188III TCNNGA 2 cut(s) 134, 241
HpyCH4III ACNGT 1 cut(s) 234
HpyCH4V TGCA 4 cut(s) 19, 29, 42, 80
Hsp92II CATG 3 cut(s) 38, 113, 219
Kzo9I GATC 1 cut(s) 175
LweI GCATC 3 cut(s) 16, 137, 149
MaeI CTAG 1 cut(s) 194
MaeIII GTNAC 1 cut(s) 196
MalI GATC 1 cut(s) 177
MboI GATC 1 cut(s) 175
MboII GAAGA 2 cut(s) 83, 170
MflI RGATCY 1 cut(s) 175
MluCI AATT 2 cut(s) 54, 81
MnlI CCTC 3 cut(s) 76, 106, 130
MseI TTAA 1 cut(s) 171
Mva1269I GAATGC 1 cut(s) 44
NcoI CCATGG 1 cut(s) 215
NdeII GATC 1 cut(s) 175
NlaIII CATG 3 cut(s) 38, 113, 219
PctI GAATGC 1 cut(s) 44
PfeI GAWTC 2 cut(s) 47, 74
PsiI TTATAA 1 cut(s) 101
PsuI RGATCY 1 cut(s) 175
SaqAI TTAA 1 cut(s) 171
Sau3AI GATC 1 cut(s) 175
SetI ASST 1 cut(s) 192
SfaNI GCATC 3 cut(s) 16, 137, 149
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
Sse9I AATT 2 cut(s) 54, 81
SspMI CTAG 1 cut(s) 194
StyI CCWWGG 1 cut(s) 215
TaaI ACNGT 1 cut(s) 234
TasI AATT 2 cut(s) 54, 81
TfiI GAWTC 2 cut(s) 47, 74
Tru1I TTAA 1 cut(s) 171
Tru9I TTAA 1 cut(s) 171
TspDTI ATGAA 1 cut(s) 51
XspI CTAG 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.