Rmu_sc0002737.1_g000006

Ripening-related protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002737.1
Physical Location & Seq
Reverse (-)
34236 .. 34520
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002737.1_g000006.1.cds

Sequence Viewer

Length: 285 bp
atgcaacaaagagaatatgtccggctgctgcaaaaaaggcaagctttaccccacttacaagtgctcaccacatgtgttacgaaggcaaccttgacgctcaacagctttcagaaaggtggtgatggtggcggagcatctgaatgtgatggtagataccattcggatagcacccctgtggtggcattgtcaacagggtggttcaacaatagcaagaggtgtttgtactacattaccatccatgctaatgggaggagtgtgaaggcaaaggtggtagatgagtgttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.42

Weight (kDa)

9.24

Isoelectric Point (pI)

52.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022634)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0354521
rosa_multiflora Rmu_sc0002737.1_g000006 Rmu_sc0007640.1_g000002
rosa_samantha Rh1AG253900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 129
AfaI GTAC 1 cut(s) 224
AfiI CCNNNNNNNGG 1 cut(s) 178
AflIII ACRYGT 1 cut(s) 71
AgsI TTSAA 1 cut(s) 202
AleI CACNNNNGTG 1 cut(s) 173
AluBI AGCT 2 cut(s) 44, 105
AluI AGCT 2 cut(s) 44, 105
Alw21I GWGCWC 1 cut(s) 66
ApeKI GCWGC 2 cut(s) 25, 28
AsuHPI GGTGA 2 cut(s) 58, 131
Bbv12I GWGCWC 1 cut(s) 66
BbvI GCAGC 2 cut(s) 12, 15
BccI CCATC 3 cut(s) 116, 140, 242
BisI GCNGC 2 cut(s) 26, 29
BlsI GCNGC 2 cut(s) 27, 30
BmsI GCATC 1 cut(s) 143
Bsc4I CCNNNNNNNGG 1 cut(s) 178
BseGI GGATG 1 cut(s) 234
BseLI CCNNNNNNNGG 1 cut(s) 178
BseRI GAGGAG 1 cut(s) 265
BseXI GCAGC 2 cut(s) 12, 15
BsiHKAI GWGCWC 1 cut(s) 66
BsiSI CCGG 1 cut(s) 22
BslI CCNNNNNNNGG 1 cut(s) 178
Bsp1286I GDGCHC 1 cut(s) 66
BspACI CCGC 1 cut(s) 129
BstC8I GCNNGC 1 cut(s) 42
BstF5I GGATG 1 cut(s) 234
BstMWI GCNNNNNNNGC 1 cut(s) 37
BstNSI RCATGY 1 cut(s) 75
BstV1I GCAGC 2 cut(s) 12, 15
BstXI CCANNNNNNTGG 1 cut(s) 245
BtsCI GGATG 1 cut(s) 234
Cac8I GCNNGC 1 cut(s) 42
CseI GACGC 1 cut(s) 103
Csp6I GTAC 1 cut(s) 223
CviAII CATG 2 cut(s) 72, 239
CviJI RGCY 3 cut(s) 25, 44, 105
CviKI_1 RGCY 3 cut(s) 25, 44, 105
CviQI GTAC 1 cut(s) 223
EciI GGCGGA 1 cut(s) 144
FaeI CATG 2 cut(s) 75, 242
FaiI YATR 3 cut(s) 18, 73, 240
FalI AAGNNNNNCTT 4 cut(s) 28, 60, 74, 106
FatI CATG 2 cut(s) 71, 238
Fnu4HI GCNGC 2 cut(s) 26, 29
FokI GGATG 1 cut(s) 221
Fsp4HI GCNGC 2 cut(s) 26, 29
GluI GCNGC 2 cut(s) 26, 29
HapII CCGG 1 cut(s) 22
HgaI GACGC 1 cut(s) 103
Hin1II CATG 2 cut(s) 75, 242
HincII GTYRAC 1 cut(s) 189
HindII GTYRAC 1 cut(s) 189
HindIII AAGCTT 1 cut(s) 42
HpaII CCGG 1 cut(s) 22
HphI GGTGA 2 cut(s) 58, 131
Hpy166II GTNNAC 1 cut(s) 189
Hpy188I TCNGA 3 cut(s) 111, 139, 163
Hpy8I GTNNAC 1 cut(s) 189
HpyAV CCTTC 2 cut(s) 76, 253
HpyCH4V TGCA 2 cut(s) 4, 31
HpyF10VI GCNNNNNNNGC 1 cut(s) 37
Hsp92II CATG 2 cut(s) 75, 242
LmnI GCTCC 1 cut(s) 131
LpnPI CCDG 3 cut(s) 35, 177, 186
Lsp1109I GCAGC 2 cut(s) 12, 15
LweI GCATC 1 cut(s) 143
MaeIII GTNAC 1 cut(s) 76
MhlI GDGCHC 1 cut(s) 66
MnlI CCTC 2 cut(s) 207, 243
MslI CAYNNNNRTG 3 cut(s) 139, 173, 243
MspI CCGG 1 cut(s) 22
MwoI GCNNNNNNNGC 1 cut(s) 37
NlaIII CATG 2 cut(s) 75, 242
NspI RCATGY 1 cut(s) 75
OliI CACNNNNGTG 1 cut(s) 173
PciI ACATGT 1 cut(s) 71
PkrI GCNGC 2 cut(s) 27, 30
PscI ACATGT 1 cut(s) 71
RsaI GTAC 1 cut(s) 224
RsaNI GTAC 1 cut(s) 223
RseI CAYNNNNRTG 3 cut(s) 139, 173, 243
SatI GCNGC 2 cut(s) 26, 29
SduI GDGCHC 1 cut(s) 66
SetI ASST 6 cut(s) 46, 92, 107, 118, 218, 270
SfaNI GCATC 1 cut(s) 143
SgeI CNNG 9 cut(s) 34, 53, 71, 84, 103, 185, 204, 223, 251
SmiMI CAYNNNNRTG 3 cut(s) 139, 173, 243
SsiI CCGC 1 cut(s) 129
TatI WGTACW 1 cut(s) 222
TseI GCWGC 2 cut(s) 25, 28
XceI RCATGY 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.