Rmu_sc0002848.1_g000021

Pyridoxal 5'-phosphate (PLP)-binding protein, which may be involved in intracellular homeostatic regulation of pyridoxal 5'-phosphate (PLP), the active form of vitamin B6

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002848.1
OG0031230
Physical Location & Seq
Reverse (-)
81752 .. 83665
1914 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 314 bp
ctaaatccggtgtcgatccttctggttgtgttgagcttgcaaaacatgtcaaattgcagtgcccaaatctagtgctttctggcttaatgacaatagggatgcgtgactatacatcaactccagagaacttcaggatgctatctaagtgtagaactgaggtatgcaaggagcttggtatggcagaggagaactttgagctgtcaatgggcatgtctggtgattttgagcaagcgattgaaatgggcagcaccaatgtcagagttggatccaccatctttgggccaagggagtatccaaagaagcaaccaaattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ala_racemase_N

Protein Analysis

103

Amino Acids

11.37

Weight (kDa)

5.84

Isoelectric Point (pI)

27.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ala_racemase_N PF01168 2 - 94 8.5e-06 Alanine racemase, N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031230)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002848.1_g000021
rosa_samantha Rh5CG311000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 10, 260, 273
AcuI CTGAAG 1 cut(s) 114
AfiI CCNNNNNNNGG 1 cut(s) 278
AflIII ACRYGT 1 cut(s) 45
AgsI TTSAA 1 cut(s) 238
AluBI AGCT 3 cut(s) 36, 171, 198
AluI AGCT 3 cut(s) 36, 171, 198
AlwI GGATC 3 cut(s) 10, 260, 273
AoxI GGCC 1 cut(s) 280
ApeKI GCWGC 1 cut(s) 245
AspS9I GGNCC 1 cut(s) 280
AsuHPI GGTGA 1 cut(s) 229
BaeGI GKGCMC 1 cut(s) 64
BamHI GGATCC 1 cut(s) 265
BbvI GCAGC 1 cut(s) 257
BccI CCATC 1 cut(s) 280
BciVI GTATCC 1 cut(s) 302
BfaI CTAG 1 cut(s) 70
BfuI GTATCC 1 cut(s) 302
BisI GCNGC 1 cut(s) 246
BlsI GCNGC 1 cut(s) 247
BmgT120I GGNCC 1 cut(s) 280
BmiI GGNNCC 1 cut(s) 267
BmsI GCATC 2 cut(s) 89, 125
BpmI CTGGAG 1 cut(s) 104
BsaJI CCNNGG 1 cut(s) 283
BsaWI WCCGGW 1 cut(s) 7
BsaXI ACNNNNNCTCC 2 cut(s) 102, 132
Bsc4I CCNNNNNNNGG 1 cut(s) 278
BseDI CCNNGG 1 cut(s) 283
BseGI GGATG 2 cut(s) 104, 140
BseLI CCNNNNNNNGG 1 cut(s) 278
BseMII CTCAG 1 cut(s) 146
BseRI GAGGAG 1 cut(s) 199
BseSI GKGCMC 1 cut(s) 64
BseXI GCAGC 1 cut(s) 257
BshFI GGCC 1 cut(s) 282
BsiSI CCGG 1 cut(s) 8
BslI CCNNNNNNNGG 1 cut(s) 278
BsnI GGCC 1 cut(s) 282
Bsp1286I GDGCHC 1 cut(s) 64
Bsp143I GATC 2 cut(s) 15, 265
BspANI GGCC 1 cut(s) 282
BspCNI CTCAG 1 cut(s) 147
BspLI GGNNCC 1 cut(s) 267
BspPI GGATC 3 cut(s) 10, 260, 273
BssECI CCNNGG 1 cut(s) 283
BssMI GATC 2 cut(s) 15, 265
BssT1I CCWWGG 1 cut(s) 283
BstC8I GCNNGC 2 cut(s) 38, 230
BstDEI CTNAG 2 cut(s) 143, 155
BstF5I GGATG 2 cut(s) 104, 140
BstKTI GATC 2 cut(s) 18, 268
BstMBI GATC 2 cut(s) 15, 265
BstNSI RCATGY 2 cut(s) 49, 213
BstSLI GKGCMC 1 cut(s) 64
BstV1I GCAGC 1 cut(s) 257
BstX2I RGATCY 1 cut(s) 265
BstYI RGATCY 1 cut(s) 265
BsuI GTATCC 1 cut(s) 302
BsuRI GGCC 1 cut(s) 282
BtsCI GGATG 2 cut(s) 104, 140
BtsI GCAGTG 1 cut(s) 64
BtsIMutI CAGTG 1 cut(s) 64
Cac8I GCNNGC 2 cut(s) 38, 230
Cfr13I GGNCC 1 cut(s) 280
CspCI CAANNNNNGTGG 2 cut(s) 258, 293
CviAII CATG 2 cut(s) 46, 210
CviJI RGCY 5 cut(s) 36, 83, 171, 198, 282
CviKI_1 RGCY 5 cut(s) 36, 83, 171, 198, 282
DdeI CTNAG 2 cut(s) 143, 155
DpnI GATC 2 cut(s) 17, 267
DpnII GATC 2 cut(s) 15, 265
Eco130I CCWWGG 1 cut(s) 283
Eco57I CTGAAG 1 cut(s) 114
EcoT14I CCWWGG 1 cut(s) 283
ErhI CCWWGG 1 cut(s) 283
FaeI CATG 2 cut(s) 49, 213
FaiI YATR 5 cut(s) 47, 110, 162, 178, 211
FatI CATG 2 cut(s) 45, 209
Fnu4HI GCNGC 1 cut(s) 246
FokI GGATG 2 cut(s) 111, 147
Fsp4HI GCNGC 1 cut(s) 246
FspBI CTAG 1 cut(s) 70
GluI GCNGC 1 cut(s) 246
GsuI CTGGAG 1 cut(s) 104
HaeIII GGCC 1 cut(s) 282
HapII CCGG 1 cut(s) 8
Hin1II CATG 2 cut(s) 49, 213
HpaII CCGG 1 cut(s) 8
HphI GGTGA 1 cut(s) 229
Hpy188I TCNGA 1 cut(s) 259
Hpy188III TCNNGA 2 cut(s) 121, 132
HpyAV CCTTC 1 cut(s) 29
HpyCH4V TGCA 3 cut(s) 40, 57, 164
HpyF3I CTNAG 2 cut(s) 143, 155
Hsp92II CATG 2 cut(s) 49, 213
Kzo9I GATC 2 cut(s) 15, 265
LmnI GCTCC 1 cut(s) 168
LpnPI CCDG 6 cut(s) 8, 21, 65, 117, 134, 200
Lsp1109I GCAGC 1 cut(s) 257
LweI GCATC 2 cut(s) 89, 125
MaeI CTAG 1 cut(s) 70
MaeIII GTNAC 1 cut(s) 103
MalI GATC 2 cut(s) 17, 267
MboI GATC 2 cut(s) 15, 265
MflI RGATCY 1 cut(s) 265
MhlI GDGCHC 1 cut(s) 64
MluCI AATT 2 cut(s) 52, 309
MmeI TCCRAC 1 cut(s) 243
MnlI CCTC 2 cut(s) 150, 177
MseI TTAA 2 cut(s) 85, 312
MspI CCGG 1 cut(s) 8
NdeII GATC 2 cut(s) 15, 265
NlaIII CATG 2 cut(s) 49, 213
NlaIV GGNNCC 1 cut(s) 267
NmuCI GTSAC 1 cut(s) 103
NspI RCATGY 2 cut(s) 49, 213
PciI ACATGT 1 cut(s) 45
PkrI GCNGC 1 cut(s) 247
PscI ACATGT 1 cut(s) 45
PspN4I GGNNCC 1 cut(s) 267
PspPI GGNCC 1 cut(s) 280
PsuI RGATCY 1 cut(s) 265
SaqAI TTAA 2 cut(s) 85, 312
SatI GCNGC 1 cut(s) 246
Sau3AI GATC 2 cut(s) 15, 265
Sau96I GGNCC 1 cut(s) 280
SduI GDGCHC 1 cut(s) 64
SetI ASST 4 cut(s) 38, 161, 173, 200
SfaNI GCATC 2 cut(s) 89, 125
Sse9I AATT 2 cut(s) 52, 309
SspMI CTAG 1 cut(s) 70
StyI CCWWGG 1 cut(s) 283
TaqI TCGA 1 cut(s) 14
TasI AATT 2 cut(s) 52, 309
Tru1I TTAA 2 cut(s) 85, 312
Tru9I TTAA 2 cut(s) 85, 312
TscAI CASTG 1 cut(s) 64
TseFI GTSAC 1 cut(s) 103
TseI GCWGC 1 cut(s) 245
Tsp45I GTSAC 1 cut(s) 103
TspRI CASTG 1 cut(s) 64
XceI RCATGY 2 cut(s) 49, 213
XspI CTAG 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.