Rmu_sc0002882.1_g000017

F-actin-capping proteins bind in a Ca(2 )-independent manner to the fast growing ends of actin filaments (barbed end) thereby blocking the exchange of subunits at these ends. Unlike other capping proteins (such as gelsolin and severin), these proteins do not sever actin filaments

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002882.1
OG0021649
Physical Location & Seq
Forward (+)
48855 .. 50154
1300 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 324 bp
atgctggaattaaaaggcaaactgcaggtgggtgcccactattttgaggaggggaatgtgcagttagatgcaaaacatgaatgcaaagattcaacaatttttcagtcctctgaagattctgcaattaccataggcaacattataaggcaacatgaggcagaatacttggcatctcttgaggcatcctattcaaacttgcccgataccacttttaaggatcttcgtagaaagcttctagttactcgcaccctatttccatggcagaatactttacagtttatcttgacaagagatatcacaaaagaacttggcattggaaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04144 map04144
Pfam Domains
Protein Families
F-actin_cap_A

Protein Analysis

107

Amino Acids

12.23

Weight (kDa)

5.89

Isoelectric Point (pI)

43.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-actin_cap_A PF01267 3 - 97 2.5e-28 F-actin capping protein alpha subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021649)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002050.1_g000003 Rmu_sc0002669.1_g000001 Rmu_sc0002882.1_g000017 Rmu_sc0008565.1_g000017
rosa_samantha Rh1AG050100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 143
AarI CACCTGC 1 cut(s) 16
Acc36I ACCTGC 1 cut(s) 16
AccB1I GGYRCC 1 cut(s) 32
AclWI GGATC 1 cut(s) 225
AcuI CTGAAG 1 cut(s) 132
AgsI TTSAA 2 cut(s) 93, 192
AjuI GAANNNNNNNTTGG 1 cut(s) 297
AluBI AGCT 1 cut(s) 232
AluI AGCT 1 cut(s) 232
AlwI GGATC 1 cut(s) 225
BaeGI GKGCMC 1 cut(s) 37
BanI GGYRCC 1 cut(s) 32
BfaI CTAG 1 cut(s) 236
BfmI CTRYAG 1 cut(s) 23
BfuAI ACCTGC 1 cut(s) 16
BmiI GGNNCC 1 cut(s) 34
BmsI GCATC 3 cut(s) 58, 179, 191
BpuEI CTTGAG 1 cut(s) 197
BsaJI CCNNGG 1 cut(s) 257
BseDI CCNNGG 1 cut(s) 257
BseGI GGATG 1 cut(s) 182
BseRI GAGGAG 1 cut(s) 62
BseSI GKGCMC 1 cut(s) 37
BsgI GTGCAG 1 cut(s) 80
BshNI GGYRCC 1 cut(s) 32
BsmI GAATGC 1 cut(s) 86
Bsp1286I GDGCHC 1 cut(s) 37
Bsp143I GATC 1 cut(s) 217
Bsp19I CCATGG 1 cut(s) 257
BspLI GGNNCC 1 cut(s) 34
BspMAI CTGCAG 1 cut(s) 27
BspMI ACCTGC 1 cut(s) 16
BspPI GGATC 1 cut(s) 225
BspT107I GGYRCC 1 cut(s) 32
BssECI CCNNGG 1 cut(s) 257
BssMI GATC 1 cut(s) 217
BssT1I CCWWGG 1 cut(s) 257
Bst4CI ACNGT 1 cut(s) 276
BstDSI CCRYGG 1 cut(s) 257
BstF5I GGATG 1 cut(s) 182
BstKTI GATC 1 cut(s) 220
BstMBI GATC 1 cut(s) 217
BstSFI CTRYAG 1 cut(s) 23
BstSLI GKGCMC 1 cut(s) 37
BstX2I RGATCY 1 cut(s) 217
BstYI RGATCY 1 cut(s) 217
BtgI CCRYGG 1 cut(s) 257
BtsCI GGATG 1 cut(s) 182
BveI ACCTGC 1 cut(s) 16
CviAII CATG 3 cut(s) 77, 152, 258
CviJI RGCY 1 cut(s) 232
CviKI_1 RGCY 1 cut(s) 232
DpnI GATC 1 cut(s) 219
DpnII GATC 1 cut(s) 217
Eco130I CCWWGG 1 cut(s) 257
Eco32I GATATC 1 cut(s) 295
Eco57I CTGAAG 1 cut(s) 132
EcoRV GATATC 1 cut(s) 295
EcoT14I CCWWGG 1 cut(s) 257
ErhI CCWWGG 1 cut(s) 257
FaeI CATG 3 cut(s) 80, 155, 261
FaiI YATR 5 cut(s) 78, 131, 143, 153, 259
FatI CATG 3 cut(s) 76, 151, 257
FokI GGATG 1 cut(s) 169
FspBI CTAG 1 cut(s) 236
Hin1II CATG 3 cut(s) 80, 155, 261
HindIII AAGCTT 1 cut(s) 230
HinfI GANTC 2 cut(s) 89, 116
Hpy188I TCNGA 1 cut(s) 112
Hpy188III TCNNGA 2 cut(s) 176, 283
HpyCH4III ACNGT 1 cut(s) 276
HpyCH4V TGCA 5 cut(s) 25, 61, 71, 84, 122
Hsp92II CATG 3 cut(s) 80, 155, 261
Kzo9I GATC 1 cut(s) 217
LpnPI CCDG 1 cut(s) 11
LweI GCATC 3 cut(s) 58, 179, 191
MaeI CTAG 1 cut(s) 236
MaeIII GTNAC 1 cut(s) 238
MalI GATC 1 cut(s) 219
MboI GATC 1 cut(s) 217
MboII GAAGA 2 cut(s) 125, 212
MflI RGATCY 1 cut(s) 217
MhlI GDGCHC 1 cut(s) 37
MluCI AATT 3 cut(s) 8, 96, 123
MnlI CCTC 5 cut(s) 40, 43, 118, 148, 172
MseI TTAA 2 cut(s) 11, 213
Mva1269I GAATGC 1 cut(s) 86
NcoI CCATGG 1 cut(s) 257
NdeII GATC 1 cut(s) 217
NlaIII CATG 3 cut(s) 80, 155, 261
NlaIV GGNNCC 1 cut(s) 34
PaqCI CACCTGC 1 cut(s) 16
PctI GAATGC 1 cut(s) 86
PfeI GAWTC 2 cut(s) 89, 116
PsiI TTATAA 1 cut(s) 143
PspN4I GGNNCC 1 cut(s) 34
PstI CTGCAG 1 cut(s) 27
PsuI RGATCY 1 cut(s) 217
SaqAI TTAA 2 cut(s) 11, 213
Sau3AI GATC 1 cut(s) 217
SduI GDGCHC 1 cut(s) 37
SetI ASST 2 cut(s) 30, 234
SfaNI GCATC 3 cut(s) 58, 179, 191
SfcI CTRYAG 1 cut(s) 23
SmlI CTYRAG 1 cut(s) 176
SmoI CTYRAG 1 cut(s) 176
Sse9I AATT 3 cut(s) 8, 96, 123
SspMI CTAG 1 cut(s) 236
StyI CCWWGG 1 cut(s) 257
TaaI ACNGT 1 cut(s) 276
TasI AATT 3 cut(s) 8, 96, 123
TfiI GAWTC 2 cut(s) 89, 116
Tru1I TTAA 2 cut(s) 11, 213
Tru9I TTAA 2 cut(s) 11, 213
TspDTI ATGAA 1 cut(s) 93
XspI CTAG 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.