Rmu_sc0002922.1_g000013

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002922.1
Physical Location & Seq
Reverse (-)
41186 .. 41437
252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002922.1_g000013.1.cds

Sequence Viewer

Length: 252 bp
atggcacagaaaattaagaagatcaacatatctgtggatgagttgaataagaaggcaggtgctaatggcttagttgctagactatccttagatgcaacaacttcccatgatataagcattgacagggagacctactctttcttaaaacaagatgaaaacaatatcattggaagggacgatattgtggcagatatatttcaagccctgaccaagaaagtcaagaggccaaacaagaacagaatgcttgattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.36

Weight (kDa)

9.35

Isoelectric Point (pI)

26.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031235)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002922.1_g000013 Rmu_sc0012915.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 47
Acc36I ACCTGC 1 cut(s) 47
AgsI TTSAA 2 cut(s) 46, 200
Alw26I GTCTC 1 cut(s) 122
AoxI GGCC 1 cut(s) 224
BcoDI GTCTC 1 cut(s) 122
BfaI CTAG 1 cut(s) 78
BfuAI ACCTGC 1 cut(s) 47
BmsI GCATC 1 cut(s) 82
BplI GAGNNNNNCTC 2 cut(s) 119, 151
BsaI GGTCTC 1 cut(s) 122
BseGI GGATG 1 cut(s) 43
BshFI GGCC 1 cut(s) 226
BslFI GGGAC 1 cut(s) 188
BsmAI GTCTC 1 cut(s) 122
BsmFI GGGAC 1 cut(s) 188
BsmI GAATGC 1 cut(s) 246
BsnI GGCC 1 cut(s) 226
Bso31I GGTCTC 1 cut(s) 122
Bsp143I GATC 1 cut(s) 21
BspANI GGCC 1 cut(s) 226
BspMI ACCTGC 1 cut(s) 47
BspTNI GGTCTC 1 cut(s) 122
BssMI GATC 1 cut(s) 21
BstDEI CTNAG 2 cut(s) 70, 88
BstF5I GGATG 1 cut(s) 43
BstKTI GATC 1 cut(s) 24
BstMAI GTCTC 1 cut(s) 122
BstMBI GATC 1 cut(s) 21
BsuRI GGCC 1 cut(s) 226
BtsCI GGATG 1 cut(s) 43
BveI ACCTGC 1 cut(s) 47
CviAII CATG 1 cut(s) 107
CviJI RGCY 3 cut(s) 69, 203, 226
CviKI_1 RGCY 3 cut(s) 69, 203, 226
DdeI CTNAG 2 cut(s) 70, 88
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
Eco31I GGTCTC 1 cut(s) 122
FaeI CATG 1 cut(s) 110
FaiI YATR 4 cut(s) 29, 108, 113, 194
FaqI GGGAC 1 cut(s) 188
FatI CATG 1 cut(s) 106
FokI GGATG 1 cut(s) 50
FspBI CTAG 1 cut(s) 78
HaeIII GGCC 1 cut(s) 226
Hin1II CATG 1 cut(s) 110
Hpy188III TCNNGA 1 cut(s) 220
HpyAV CCTTC 2 cut(s) 46, 165
HpyCH4V TGCA 1 cut(s) 95
HpyF3I CTNAG 2 cut(s) 70, 88
Hsp92II CATG 1 cut(s) 110
Kzo9I GATC 1 cut(s) 21
LpnPI CCDG 3 cut(s) 42, 109, 218
LweI GCATC 1 cut(s) 82
MaeI CTAG 1 cut(s) 78
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MboII GAAGA 1 cut(s) 31
MluCI AATT 1 cut(s) 12
MnlI CCTC 1 cut(s) 216
MseI TTAA 2 cut(s) 15, 143
MslI CAYNNNNRTG 1 cut(s) 32
Mva1269I GAATGC 1 cut(s) 246
NdeII GATC 1 cut(s) 21
NlaIII CATG 1 cut(s) 110
PaqCI CACCTGC 1 cut(s) 47
PctI GAATGC 1 cut(s) 246
RseI CAYNNNNRTG 1 cut(s) 32
SaqAI TTAA 2 cut(s) 15, 143
Sau3AI GATC 1 cut(s) 21
SetI ASST 2 cut(s) 61, 134
SfaNI GCATC 1 cut(s) 82
SmiMI CAYNNNNRTG 1 cut(s) 32
Sse9I AATT 1 cut(s) 12
SspMI CTAG 1 cut(s) 78
TasI AATT 1 cut(s) 12
Tru1I TTAA 2 cut(s) 15, 143
Tru9I TTAA 2 cut(s) 15, 143
TspDTI ATGAA 1 cut(s) 168
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.