Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003229.1

Orthogroup ID

OG0022265

Physical Location & Seq

Genomic Coordinates Reverse (-)

37464 .. 38772

Gene Structure 1309 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 627 bp

atggaggaatggggtgaggacagggatggtcttatagatctgtttgggaaggttagggatgagtggatggaccaggacttgaaaacttggattgctgcaaatagattatatccaggtgtccctgatgctctaaaattcacaagctctaccatatacgttgtcactacgaaacagagcagatttgctgacgctttattgcgagaactagcaggagttacaataccgcctgaaagaatctttggtcttggatctggtccaaaggtagaagtattgaagcaacttcagaagaaacatcaggggctcaaactgcactttttggaggatagactggcaaccctaaagaatgtcatcagagaacctgaattggatggctggaatttgtatctaggtaaacttcctctttctatttttctcctcttagtattaaatgatactgctaaagtgctaaactcgcctgttatcattgctgtgtttgctttattgtggtacttaatagctttggttgctaatttgggttttgaattaggggattgggggtacaatacacagaaagagagagacgaagctgctagaattccaaggattcagattcttccgctttctgactttagtaagaaactcaagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

208

Amino Acids

23.66

Weight (kDa)

6.76

Isoelectric Point (pI)

22.39

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022265)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g14570
malus_domestica	MD09G1245300.v1.1
rosa_laevigata	RLG00000028109
rosa_multiflora	Rmu_sc0003229.1_g000014

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	224, 596
AclWI	GGATC	1 cut(s)	256
AcsI	RAATTY	3 cut(s)	134, 376, 573
AcuI	CTGAAG	1 cut(s)	266
AfaI	GTAC	2 cut(s)	488, 539
AgsI	TTSAA	3 cut(s)	82, 274, 521
AjnI	CCWGG	2 cut(s)	72, 112
AjuI	GAANNNNNNNTTGG	2 cut(s)	222, 254
AluBI	AGCT	3 cut(s)	144, 497, 566
AluI	AGCT	3 cut(s)	144, 497, 566
Alw26I	GTCTC	1 cut(s)	552
AlwI	GGATC	1 cut(s)	256
ApeKI	GCWGC	2 cut(s)	95, 566
ApoI	RAATTY	3 cut(s)	134, 376, 573
AspS9I	GGNCC	2 cut(s)	70, 254
AsuHPI	GGTGA	1 cut(s)	26
AvaII	GGWCC	2 cut(s)	70, 254
BanII	GRGCYC	1 cut(s)	303
BbvI	GCAGC	2 cut(s)	82, 553
BccI	CCATC	3 cut(s)	20, 61, 362
BciT130I	CCWGG	2 cut(s)	74, 114
BcoDI	GTCTC	1 cut(s)	552
BfaI	CTAG	3 cut(s)	206, 386, 570
BglII	AGATCT	1 cut(s)	37
BisI	GCNGC	2 cut(s)	96, 567
BlsI	GCNGC	2 cut(s)	97, 568
Bme1390I	CCNGG	2 cut(s)	74, 114
Bme18I	GGWCC	2 cut(s)	70, 254
BmgT120I	GGNCC	2 cut(s)	70, 254
BmrFI	CCNGG	2 cut(s)	74, 114
BmsI	GCATC	1 cut(s)	115
BpuEI	CTTGAG	1 cut(s)	605
BsaJI	CCNNGG	1 cut(s)	578
Bse1I	ACTGG	1 cut(s)	333
Bse3DI	GCAATG	1 cut(s)	462
BseBI	CCWGG	2 cut(s)	74, 114
BseDI	CCNNGG	1 cut(s)	578
BseGI	GGATG	4 cut(s)	31, 64, 72, 373
BseMI	GCAATG	1 cut(s)	462
BseNI	ACTGG	1 cut(s)	333
BseRI	GAGGAG	1 cut(s)	404
BseXI	GCAGC	2 cut(s)	82, 553
BsgI	GTGCAG	1 cut(s)	293
BslFI	GGGAC	1 cut(s)	104
BsmAI	GTCTC	1 cut(s)	552
BsmBI	CGTCTC	1 cut(s)	552
BsmFI	GGGAC	1 cut(s)	104
Bsp1286I	GDGCHC	1 cut(s)	303
Bsp143I	GATC	2 cut(s)	37, 248
BspACI	CCGC	2 cut(s)	224, 596
BspPI	GGATC	1 cut(s)	256
BsrDI	GCAATG	1 cut(s)	462
BsrI	ACTGG	1 cut(s)	333
BssECI	CCNNGG	1 cut(s)	578
BssMI	GATC	2 cut(s)	37, 248
BssT1I	CCWWGG	1 cut(s)	578
Bst2UI	CCWGG	2 cut(s)	74, 114
BstDEI	CTNAG	1 cut(s)	418
BstF5I	GGATG	4 cut(s)	31, 64, 72, 373
BstKTI	GATC	2 cut(s)	40, 251
BstMAI	GTCTC	1 cut(s)	552
BstMBI	GATC	2 cut(s)	37, 248
BstMWI	GCNNNNNNNGC	4 cut(s)	307, 451, 473, 503
BstNI	CCWGG	2 cut(s)	74, 114
BstSCI	CCNGG	2 cut(s)	72, 112
BstV1I	GCAGC	2 cut(s)	82, 553
BstX2I	RGATCY	2 cut(s)	37, 248
BstYI	RGATCY	2 cut(s)	37, 248
BtsCI	GGATG	4 cut(s)	31, 64, 72, 373
Cfr13I	GGNCC	2 cut(s)	70, 254
CseI	GACGC	1 cut(s)	197
Csp6I	GTAC	2 cut(s)	487, 538
CviJI	RGCY	5 cut(s)	144, 301, 372, 497, 566
CviKI_1	RGCY	5 cut(s)	144, 301, 372, 497, 566
CviQI	GTAC	2 cut(s)	487, 538
DdeI	CTNAG	1 cut(s)	418
DpnI	GATC	2 cut(s)	39, 250
DpnII	GATC	2 cut(s)	37, 248
Eco130I	CCWWGG	1 cut(s)	578
Eco24I	GRGCYC	1 cut(s)	303
Eco47I	GGWCC	2 cut(s)	70, 254
Eco57I	CTGAAG	1 cut(s)	266
EcoRI	GAATTC	1 cut(s)	573
EcoRII	CCWGG	2 cut(s)	72, 112
EcoT14I	CCWWGG	1 cut(s)	578
EcoT38I	GRGCYC	1 cut(s)	303
ErhI	CCWWGG	1 cut(s)	578
Esp3I	CGTCTC	1 cut(s)	552
FaiI	YATR	4 cut(s)	35, 109, 152, 154
FaqI	GGGAC	1 cut(s)	104
Fnu4HI	GCNGC	2 cut(s)	96, 567
FokI	GGATG	4 cut(s)	38, 71, 79, 380
FriOI	GRGCYC	1 cut(s)	303
Fsp4HI	GCNGC	2 cut(s)	96, 567
FspBI	CTAG	3 cut(s)	206, 386, 570
GluI	GCNGC	2 cut(s)	96, 567
HgaI	GACGC	1 cut(s)	197
HinfI	GANTC	3 cut(s)	234, 583, 589
HphI	GGTGA	1 cut(s)	26
Hpy166II	GTNNAC	1 cut(s)	392
Hpy188I	TCNGA	4 cut(s)	285, 353, 588, 604
Hpy8I	GTNNAC	1 cut(s)	392
HpyAV	CCTTC	1 cut(s)	43
HpyCH4IV	ACGT	1 cut(s)	156
HpyCH4V	TGCA	2 cut(s)	98, 310
HpyF10VI	GCNNNNNNNGC	4 cut(s)	307, 451, 473, 503
HpyF3I	CTNAG	1 cut(s)	418
HpySE526I	ACGT	1 cut(s)	156
Kzo9I	GATC	2 cut(s)	37, 248
Lsp1109I	GCAGC	2 cut(s)	82, 553
LweI	GCATC	1 cut(s)	115
MaeI	CTAG	3 cut(s)	206, 386, 570
MaeII	ACGT	1 cut(s)	156
MaeIII	GTNAC	2 cut(s)	160, 214
MalI	GATC	2 cut(s)	39, 250
MboI	GATC	2 cut(s)	37, 248
MboII	GAAGA	2 cut(s)	298, 584
MflI	RGATCY	2 cut(s)	37, 248
MhlI	GDGCHC	1 cut(s)	303
MluCI	AATT	6 cut(s)	134, 362, 376, 508, 521, 573
MnlI	CCTC	4 cut(s)	10, 313, 408, 425
MseI	TTAA	2 cut(s)	425, 491
MslI	CAYNNNNRTG	1 cut(s)	467
MspR9I	CCNGG	2 cut(s)	74, 114
MvaI	CCWGG	2 cut(s)	74, 114
MwoI	GCNNNNNNNGC	4 cut(s)	307, 451, 473, 503
NdeII	GATC	2 cut(s)	37, 248
NmuCI	GTSAC	1 cut(s)	160
PfeI	GAWTC	3 cut(s)	234, 583, 589
PkrI	GCNGC	2 cut(s)	97, 568
Psp6I	CCWGG	2 cut(s)	72, 112
PspGI	CCWGG	2 cut(s)	72, 112
PspPI	GGNCC	2 cut(s)	70, 254
PsuI	RGATCY	2 cut(s)	37, 248
RsaI	GTAC	2 cut(s)	488, 539
RsaNI	GTAC	2 cut(s)	487, 538
RseI	CAYNNNNRTG	1 cut(s)	467
SaqAI	TTAA	2 cut(s)	425, 491
SatI	GCNGC	2 cut(s)	96, 567
Sau3AI	GATC	2 cut(s)	37, 248
Sau96I	GGNCC	2 cut(s)	70, 254
ScrFI	CCNGG	2 cut(s)	74, 114
SduI	GDGCHC	1 cut(s)	303
SetI	ASST	9 cut(s)	54, 118, 146, 159, 264, 361, 391, 499, 568
SfaNI	GCATC	1 cut(s)	115
SinI	GGWCC	2 cut(s)	70, 254
SmiMI	CAYNNNNRTG	1 cut(s)	467
SmlI	CTYRAG	1 cut(s)	620
SmoI	CTYRAG	1 cut(s)	620
Sse9I	AATT	6 cut(s)	134, 362, 376, 508, 521, 573
SsiI	CCGC	2 cut(s)	224, 596
SspMI	CTAG	3 cut(s)	206, 386, 570
StyD4I	CCNGG	2 cut(s)	72, 112
StyI	CCWWGG	1 cut(s)	578
TaiI	ACGT	1 cut(s)	159
TasI	AATT	6 cut(s)	134, 362, 376, 508, 521, 573
TfiI	GAWTC	3 cut(s)	234, 583, 589
Tru1I	TTAA	2 cut(s)	425, 491
Tru9I	TTAA	2 cut(s)	425, 491
TseFI	GTSAC	1 cut(s)	160
TseI	GCWGC	2 cut(s)	95, 566
Tsp45I	GTSAC	1 cut(s)	160
VpaK11BI	GGWCC	2 cut(s)	70, 254
XapI	RAATTY	3 cut(s)	134, 376, 573
XspI	CTAG	3 cut(s)	206, 386, 570

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.