Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003368.1

Orthogroup ID

OG0029380

Physical Location & Seq

Genomic Coordinates Reverse (-)

194542 .. 194856

Gene Structure 315 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003368.1_g000038.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 315 bp

atgctcacagtacaacaattatcttcacccatcactggaatcgataccttgatatctagcttcgagcctataggattccaagtagggccttttgctgaaaactatttgatcgaggaactcaacatcccaaaatctagactggttcctcttggttcaccagaagaatatgcaaatgccctcaaggaaagaactgttgctgctgtggttgatgaaaggccttatatagaactcttcctctcagataactgcatgttctcaatcagagggacagaattcaccaaaagtggctggggatttgtgagtacctcaacataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0003674 GO:0004888 GO:0005215 GO:0005216 GO:0005261 GO:0005262 GO:0005575 GO:0005623 GO:0005886 GO:0006810 GO:0006811 GO:0006812 GO:0006816 GO:0007154 GO:0007165 GO:0008066 GO:0008150 GO:0008324 GO:0009719 GO:0009987 GO:0010033 GO:0010243 GO:0015075 GO:0015085 GO:0015267 GO:0015318 GO:0016020 GO:0019722 GO:0019932 GO:0022803 GO:0022838 GO:0022857 GO:0022890 GO:0023052 GO:0030001 GO:0034220 GO:0035556 GO:0038023 GO:0042221 GO:0043200 GO:0044464 GO:0046873 GO:0050789 GO:0050794 GO:0050896 GO:0051179 GO:0051234 GO:0051716 GO:0055085 GO:0060089 GO:0065007 GO:0070588 GO:0070838 GO:0070887 GO:0071229 GO:0071230 GO:0071310 GO:0071417 GO:0071495 GO:0071944 GO:0072511 GO:0098655 GO:0098660 GO:0098662 GO:1901698 GO:1901699 GO:1901700 GO:1901701

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ANF_receptor Lig_chan SBP_bac_3

Protein Analysis

104

Amino Acids

11.51

Weight (kDa)

4.45

Isoelectric Point (pI)

52.17

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029380)

Species	Orthologous Gene IDs
pyrus_communis	pycom10g12170
rosa_multiflora	Rmu_sc0003368.1_g000038

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	272
AfaI	GTAC	2 cut(s)	12, 304
AfiI	CCNNNNNNNGG	1 cut(s)	35
AloI	GAACNNNNNNTCC	2 cut(s)	108, 140
AluBI	AGCT	1 cut(s)	60
AluI	AGCT	1 cut(s)	60
AoxI	GGCC	2 cut(s)	86, 215
ApeKI	GCWGC	1 cut(s)	197
ApoI	RAATTY	1 cut(s)	272
AspS9I	GGNCC	1 cut(s)	86
AsuHPI	GGTGA	3 cut(s)	18, 147, 268
BbvI	GCAGC	1 cut(s)	184
BccI	CCATC	1 cut(s)	38
BfaI	CTAG	2 cut(s)	57, 135
BfmI	CTRYAG	1 cut(s)	69
BisI	GCNGC	1 cut(s)	198
BlsI	GCNGC	1 cut(s)	199
BmgT120I	GGNCC	1 cut(s)	86
BmiI	GGNNCC	1 cut(s)	144
BpuEI	CTTGAG	1 cut(s)	164
Bsa29I	ATCGAT	1 cut(s)	42
Bsc4I	CCNNNNNNNGG	1 cut(s)	35
Bse1I	ACTGG	2 cut(s)	40, 144
BseCI	ATCGAT	1 cut(s)	42
BseGI	GGATG	1 cut(s)	123
BseLI	CCNNNNNNNGG	1 cut(s)	35
BseMII	CTCAG	1 cut(s)	252
BseNI	ACTGG	2 cut(s)	40, 144
BseXI	GCAGC	1 cut(s)	184
BseYI	CCCAGC	1 cut(s)	288
BshFI	GGCC	2 cut(s)	88, 217
BshVI	ATCGAT	1 cut(s)	42
BslFI	GGGAC	1 cut(s)	280
BslI	CCNNNNNNNGG	1 cut(s)	35
BsmFI	GGGAC	1 cut(s)	280
BsnI	GGCC	2 cut(s)	88, 217
Bsp143I	GATC	1 cut(s)	108
BspANI	GGCC	2 cut(s)	88, 217
BspCNI	CTCAG	1 cut(s)	251
BspDI	ATCGAT	1 cut(s)	42
BspLI	GGNNCC	1 cut(s)	144
BsrI	ACTGG	2 cut(s)	40, 144
BssMI	GATC	1 cut(s)	108
Bst4CI	ACNGT	2 cut(s)	10, 193
Bst6I	CTCTTC	1 cut(s)	236
BstDEI	CTNAG	1 cut(s)	238
BstF5I	GGATG	1 cut(s)	123
BstKTI	GATC	1 cut(s)	111
BstMBI	GATC	1 cut(s)	108
BstNSI	RCATGY	1 cut(s)	253
BstSFI	CTRYAG	1 cut(s)	69
BstV1I	GCAGC	1 cut(s)	184
Bsu15I	ATCGAT	1 cut(s)	42
BsuRI	GGCC	2 cut(s)	88, 217
BsuTUI	ATCGAT	1 cut(s)	42
BtsCI	GGATG	1 cut(s)	123
BtsIMutI	CAGTG	1 cut(s)	33
Cfr13I	GGNCC	1 cut(s)	86
ClaI	ATCGAT	1 cut(s)	42
Csp6I	GTAC	2 cut(s)	11, 303
CviAII	CATG	1 cut(s)	250
CviJI	RGCY	5 cut(s)	60, 67, 88, 217, 288
CviKI_1	RGCY	5 cut(s)	60, 67, 88, 217, 288
CviQI	GTAC	2 cut(s)	11, 303
DdeI	CTNAG	1 cut(s)	238
DpnI	GATC	1 cut(s)	110
DpnII	GATC	1 cut(s)	108
Eam1104I	CTCTTC	1 cut(s)	236
EarI	CTCTTC	1 cut(s)	236
Eco147I	AGGCCT	1 cut(s)	217
Eco32I	GATATC	1 cut(s)	54
EcoO109I	RGGNCCY	1 cut(s)	86
EcoRI	GAATTC	1 cut(s)	272
EcoRV	GATATC	1 cut(s)	54
FaeI	CATG	1 cut(s)	253
FaiI	YATR	6 cut(s)	71, 168, 222, 224, 251, 313
FaqI	GGGAC	1 cut(s)	280
FatI	CATG	1 cut(s)	249
Fnu4HI	GCNGC	1 cut(s)	198
FokI	GGATG	1 cut(s)	110
Fsp4HI	GCNGC	1 cut(s)	198
FspBI	CTAG	2 cut(s)	57, 135
GluI	GCNGC	1 cut(s)	198
GsaI	CCCAGC	1 cut(s)	292
HaeIII	GGCC	2 cut(s)	88, 217
Hin1II	CATG	1 cut(s)	253
HinfI	GANTC	2 cut(s)	39, 75
HphI	GGTGA	3 cut(s)	18, 147, 268
Hpy166II	GTNNAC	1 cut(s)	155
Hpy188I	TCNGA	2 cut(s)	241, 263
Hpy188III	TCNNGA	1 cut(s)	135
Hpy8I	GTNNAC	1 cut(s)	155
HpyCH4III	ACNGT	2 cut(s)	10, 193
HpyCH4V	TGCA	2 cut(s)	170, 249
HpyF3I	CTNAG	1 cut(s)	238
Hsp92II	CATG	1 cut(s)	253
Kzo9I	GATC	1 cut(s)	108
LpnPI	CCDG	4 cut(s)	21, 125, 171, 274
Lsp1109I	GCAGC	1 cut(s)	184
MaeI	CTAG	2 cut(s)	57, 135
MalI	GATC	1 cut(s)	110
MboI	GATC	1 cut(s)	108
MboII	GAAGA	3 cut(s)	15, 173, 223
MluCI	AATT	2 cut(s)	17, 272
MnlI	CCTC	5 cut(s)	106, 156, 188, 245, 257
NdeII	GATC	1 cut(s)	108
NlaIII	CATG	1 cut(s)	253
NlaIV	GGNNCC	1 cut(s)	144
NspI	RCATGY	1 cut(s)	253
PceI	AGGCCT	1 cut(s)	217
PfeI	GAWTC	2 cut(s)	39, 75
PkrI	GCNGC	1 cut(s)	199
PspFI	CCCAGC	1 cut(s)	288
PspN4I	GGNNCC	1 cut(s)	144
PspPI	GGNCC	1 cut(s)	86
RsaI	GTAC	2 cut(s)	12, 304
RsaNI	GTAC	2 cut(s)	11, 303
SatI	GCNGC	1 cut(s)	198
Sau3AI	GATC	1 cut(s)	108
Sau96I	GGNCC	1 cut(s)	86
SetI	ASST	3 cut(s)	50, 62, 308
SfcI	CTRYAG	1 cut(s)	69
SmlI	CTYRAG	1 cut(s)	179
SmoI	CTYRAG	1 cut(s)	179
Sse9I	AATT	2 cut(s)	17, 272
SseBI	AGGCCT	1 cut(s)	217
SspMI	CTAG	2 cut(s)	57, 135
StuI	AGGCCT	1 cut(s)	217
TaaI	ACNGT	2 cut(s)	10, 193
TaqI	TCGA	3 cut(s)	42, 63, 111
TasI	AATT	2 cut(s)	17, 272
TatI	WGTACW	1 cut(s)	10
TfiI	GAWTC	2 cut(s)	39, 75
TscAI	CASTG	1 cut(s)	40
TseI	GCWGC	1 cut(s)	197
TspDTI	ATGAA	1 cut(s)	225
TspRI	CASTG	1 cut(s)	40
XapI	RAATTY	1 cut(s)	272
XbaI	TCTAGA	1 cut(s)	134
XceI	RCATGY	1 cut(s)	253
XspI	CTAG	2 cut(s)	57, 135

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.