Rmu_sc0003953.1_g000032

Catalyzes the formation of formate and 2-keto-4- methylthiobutyrate (KMTB) from 1,2-dihydroxy-3-keto-5- methylthiopentene (DHK-MTPene)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003953.1
Physical Location & Seq
Forward (+)
118338 .. 120210
1873 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003953.1_g000032.1.cds

Sequence Viewer

Length: 369 bp
atgtggcaagaattggcttgcggaaattatctgaactcccatgatggtagtcatcagggggaggtgcagacatcagagggagatgtctacatgttcgtctctaatcgtgaaggctggcgtttagctgctgataactatgaaacagatgaggagttaaagaagattcgtgaagaccgtgtagtcaatatcttaaattcatgggtagaccttctgaaaaatatgttcaatatatggcaggcaatgcggcttttcgttggtgatcaaatttggactccattcaatcgccctcacgacgatcttccaccaaggaaggagtacctcaaagcttttttggataaagaagctggtgaacatgcagctgcagcctga

Protein Analysis

122

Amino Acids

14.24

Weight (kDa)

4.88

Isoelectric Point (pI)

26.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024706)

Species Orthologous Gene IDs
pyrus_communis pycom16g16810
rosa_multiflora Rmu_sc0003953.1_g000032 Rmu_sc0005661.1_g000003

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 179
AccI GTMKAC 2 cut(s) 87, 204
AciI CCGC 2 cut(s) 21, 244
AcsI RAATTY 2 cut(s) 193, 264
AfaI GTAC 1 cut(s) 317
AflIII ACRYGT 1 cut(s) 90
AgsI TTSAA 2 cut(s) 226, 280
AluBI AGCT 4 cut(s) 125, 326, 344, 359
AluI AGCT 4 cut(s) 125, 326, 344, 359
Alw26I GTCTC 1 cut(s) 103
ApeKI GCWGC 4 cut(s) 125, 356, 359, 362
ApoI RAATTY 2 cut(s) 193, 264
AsuHPI GGTGA 2 cut(s) 269, 359
BbsI GAAGAC 1 cut(s) 177
BbvI GCAGC 2 cut(s) 112, 346
BccI CCATC 1 cut(s) 38
BclI TGATCA 1 cut(s) 259
BcoDI GTCTC 1 cut(s) 103
BfmI CTRYAG 1 cut(s) 360
BisI GCNGC 5 cut(s) 126, 245, 357, 360, 363
BlsI GCNGC 5 cut(s) 127, 246, 358, 361, 364
BpiI GAAGAC 1 cut(s) 177
BsaJI CCNNGG 1 cut(s) 305
Bse3DI GCAATG 1 cut(s) 246
BseDI CCNNGG 1 cut(s) 305
BseMI GCAATG 1 cut(s) 246
BseRI GAGGAG 1 cut(s) 164
BseXI GCAGC 2 cut(s) 112, 346
BsgI GTGCAG 1 cut(s) 86
BsmAI GTCTC 1 cut(s) 103
BsmBI CGTCTC 1 cut(s) 103
Bsp143I GATC 2 cut(s) 259, 295
BspACI CCGC 2 cut(s) 21, 244
BspMAI CTGCAG 1 cut(s) 364
BsrDI GCAATG 1 cut(s) 246
BssECI CCNNGG 1 cut(s) 305
BssMI GATC 2 cut(s) 259, 295
BssT1I CCWWGG 1 cut(s) 305
Bst4CI ACNGT 1 cut(s) 176
BstAPI GCANNNNNTGC 1 cut(s) 241
BstC8I GCNNGC 3 cut(s) 19, 116, 237
BstKTI GATC 2 cut(s) 262, 298
BstMAI GTCTC 1 cut(s) 103
BstMBI GATC 2 cut(s) 259, 295
BstMWI GCNNNNNNNGC 2 cut(s) 241, 362
BstNSI RCATGY 2 cut(s) 94, 356
BstSFI CTRYAG 1 cut(s) 360
BstV1I GCAGC 2 cut(s) 112, 346
BstV2I GAAGAC 1 cut(s) 177
Cac8I GCNNGC 3 cut(s) 19, 116, 237
Csp6I GTAC 1 cut(s) 316
CviAII CATG 4 cut(s) 41, 91, 198, 353
CviJI RGCY 8 cut(s) 17, 114, 125, 247, 326, 344, 359, 365
CviKI_1 RGCY 8 cut(s) 17, 114, 125, 247, 326, 344, 359, 365
CviQI GTAC 1 cut(s) 316
DpnI GATC 2 cut(s) 261, 297
DpnII GATC 2 cut(s) 259, 295
DrdI GACNNNNNNGTC 1 cut(s) 179
DseDI GACNNNNNNGTC 1 cut(s) 179
Eco130I CCWWGG 1 cut(s) 305
EcoT14I CCWWGG 1 cut(s) 305
ErhI CCWWGG 1 cut(s) 305
Esp3I CGTCTC 1 cut(s) 103
FaeI CATG 4 cut(s) 44, 94, 201, 356
FaiI YATR 8 cut(s) 42, 92, 138, 199, 221, 230, 232, 354
FatI CATG 4 cut(s) 40, 90, 197, 352
FbaI TGATCA 1 cut(s) 259
FblI GTMKAC 2 cut(s) 87, 204
Fnu4HI GCNGC 5 cut(s) 126, 245, 357, 360, 363
Fsp4HI GCNGC 5 cut(s) 126, 245, 357, 360, 363
GluI GCNGC 5 cut(s) 126, 245, 357, 360, 363
Hin1II CATG 4 cut(s) 44, 94, 201, 356
HindIII AAGCTT 1 cut(s) 324
HinfI GANTC 2 cut(s) 163, 271
HphI GGTGA 2 cut(s) 269, 359
Hpy166II GTNNAC 3 cut(s) 88, 205, 350
Hpy188I TCNGA 3 cut(s) 33, 76, 213
Hpy188III TCNNGA 3 cut(s) 107, 167, 290
Hpy8I GTNNAC 3 cut(s) 88, 205, 350
Hpy99I CGWCG 1 cut(s) 296
HpyAV CCTTC 3 cut(s) 104, 218, 304
HpyCH4III ACNGT 1 cut(s) 176
HpyCH4V TGCA 3 cut(s) 67, 356, 362
HpyF10VI GCNNNNNNNGC 2 cut(s) 241, 362
Hsp92II CATG 4 cut(s) 44, 94, 201, 356
Ksp22I TGATCA 1 cut(s) 259
Kzo9I GATC 2 cut(s) 259, 295
LpnPI CCDG 4 cut(s) 41, 100, 221, 330
Lsp1109I GCAGC 2 cut(s) 112, 346
MalI GATC 2 cut(s) 261, 297
MboI GATC 2 cut(s) 259, 295
MboII GAAGA 3 cut(s) 172, 182, 290
MluCI AATT 4 cut(s) 11, 25, 193, 264
MlyI GAGTC 1 cut(s) 265
MnlI CCTC 5 cut(s) 55, 70, 142, 297, 329
MseI TTAA 2 cut(s) 155, 191
MspA1I CMGCKG 1 cut(s) 359
MwoI GCNNNNNNNGC 2 cut(s) 241, 362
NdeII GATC 2 cut(s) 259, 295
NlaIII CATG 4 cut(s) 44, 94, 201, 356
NspI RCATGY 2 cut(s) 94, 356
PciI ACATGT 1 cut(s) 90
PcsI WCGNNNNNNNCGW 1 cut(s) 172
PfeI GAWTC 1 cut(s) 163
PkrI GCNGC 5 cut(s) 127, 246, 358, 361, 364
PleI GAGTC 1 cut(s) 265
PpsI GAGTC 1 cut(s) 265
PscI ACATGT 1 cut(s) 90
PstI CTGCAG 1 cut(s) 364
PvuII CAGCTG 1 cut(s) 359
RsaI GTAC 1 cut(s) 317
RsaNI GTAC 1 cut(s) 316
SaqAI TTAA 2 cut(s) 155, 191
SatI GCNGC 5 cut(s) 126, 245, 357, 360, 363
Sau3AI GATC 2 cut(s) 259, 295
SchI GAGTC 1 cut(s) 265
SetI ASST 7 cut(s) 66, 127, 210, 321, 328, 346, 361
SfcI CTRYAG 1 cut(s) 360
Sse9I AATT 4 cut(s) 11, 25, 193, 264
SsiI CCGC 2 cut(s) 21, 244
StyI CCWWGG 1 cut(s) 305
TaaI ACNGT 1 cut(s) 176
TasI AATT 4 cut(s) 11, 25, 193, 264
TauI GCSGC 1 cut(s) 247
TfiI GAWTC 1 cut(s) 163
Tru1I TTAA 2 cut(s) 155, 191
Tru9I TTAA 2 cut(s) 155, 191
TseI GCWGC 4 cut(s) 125, 356, 359, 362
TspDTI ATGAA 2 cut(s) 153, 186
XapI RAATTY 2 cut(s) 193, 264
XceI RCATGY 2 cut(s) 94, 356
XmiI GTMKAC 2 cut(s) 87, 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.