Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003994.1

Orthogroup ID

OG0031289

Physical Location & Seq

Genomic Coordinates Reverse (-)

74358 .. 74690

Gene Structure 333 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003994.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 333 bp

atgcagatgagtatgatcatcactgagtccttaaggctatattctcctgttatttacattccaaggagagttgaaaagaaagttaaacttggaaagctcattgttcctgctgatgttgagttaatcatcccatatctagtactacaccatgaccttcaatcctggggacaagacgcacatcttttcaaaccagacagattctcagaaggagttgctaaagctactaacaacaacatagctacattcttaccattttctatggaacataggaattgtgtgggcactaactttgccaccattgaagccaagattgctctttcaatgatcctatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004497 GO:0006629 GO:0008150 GO:0008152 GO:0008202 GO:0008395 GO:0009719 GO:0009725 GO:0009741 GO:0010033 GO:0010268 GO:0010817 GO:0014070 GO:0016128 GO:0016131 GO:0016491 GO:0033993 GO:0042221 GO:0042445 GO:0042592 GO:0044238 GO:0048878 GO:0050896 GO:0055088 GO:0055114 GO:0065007 GO:0065008 GO:0071704 GO:1901360 GO:1901615 GO:1901700

KEGG Pathways

Metabolic & Signaling

ko00905 map00905

Pfam Domains

Protein Families

p450

Protein Analysis

110

Amino Acids

12.5

Weight (kDa)

8.82

Isoelectric Point (pI)

39.58

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031289)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_co8482715.1_g000001 Rmu_sc0003994.1_g000012

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	319
AfaI	GTAC	1 cut(s)	141
AflII	CTTAAG	1 cut(s)	31
AgsI	TTSAA	5 cut(s)	74, 158, 187, 302, 321
AjnI	CCWGG	1 cut(s)	161
AluBI	AGCT	3 cut(s)	97, 221, 239
AluI	AGCT	3 cut(s)	97, 221, 239
AlwI	GGATC	1 cut(s)	319
BaeGI	GKGCMC	1 cut(s)	284
BciT130I	CCWGG	1 cut(s)	163
BclI	TGATCA	1 cut(s)	15
BfaI	CTAG	1 cut(s)	137
BfmI	CTRYAG	1 cut(s)	329
BfrI	CTTAAG	1 cut(s)	31
BmcAI	AGTACT	1 cut(s)	141
Bme1390I	CCNGG	1 cut(s)	163
BmrFI	CCNGG	1 cut(s)	163
BsaJI	CCNNGG	2 cut(s)	62, 162
BseBI	CCWGG	1 cut(s)	163
BseDI	CCNNGG	2 cut(s)	62, 162
BseGI	GGATG	1 cut(s)	126
BseMII	CTCAG	2 cut(s)	15, 216
BseSI	GKGCMC	1 cut(s)	284
BslFI	GGGAC	1 cut(s)	180
BsmFI	GGGAC	1 cut(s)	180
Bsp1286I	GDGCHC	1 cut(s)	284
Bsp143I	GATC	2 cut(s)	15, 324
BspCNI	CTCAG	2 cut(s)	16, 215
BspPI	GGATC	1 cut(s)	319
BspTI	CTTAAG	1 cut(s)	31
BssECI	CCNNGG	2 cut(s)	62, 162
BssMI	GATC	2 cut(s)	15, 324
BssT1I	CCWWGG	1 cut(s)	62
Bst2UI	CCWGG	1 cut(s)	163
BstAFI	CTTAAG	1 cut(s)	31
BstDEI	CTNAG	2 cut(s)	24, 202
BstF5I	GGATG	1 cut(s)	126
BstKTI	GATC	2 cut(s)	18, 327
BstMBI	GATC	2 cut(s)	15, 324
BstMWI	GCNNNNNNNGC	1 cut(s)	311
BstNI	CCWGG	1 cut(s)	163
BstSCI	CCNGG	1 cut(s)	161
BstSFI	CTRYAG	1 cut(s)	329
BstSLI	GKGCMC	1 cut(s)	284
BtsCI	GGATG	1 cut(s)	126
BtsIMutI	CAGTG	1 cut(s)	21
CseI	GACGC	1 cut(s)	182
Csp6I	GTAC	1 cut(s)	140
CviAII	CATG	1 cut(s)	149
CviJI	RGCY	5 cut(s)	37, 97, 221, 239, 305
CviKI_1	RGCY	5 cut(s)	37, 97, 221, 239, 305
CviQI	GTAC	1 cut(s)	140
DdeI	CTNAG	2 cut(s)	24, 202
DpnI	GATC	2 cut(s)	17, 326
DpnII	GATC	2 cut(s)	15, 324
Eco130I	CCWWGG	1 cut(s)	62
EcoRII	CCWGG	1 cut(s)	161
EcoT14I	CCWWGG	1 cut(s)	62
ErhI	CCWWGG	1 cut(s)	62
FaeI	CATG	1 cut(s)	152
FaiI	YATR	8 cut(s)	14, 40, 133, 150, 236, 260, 267, 331
FalI	AAGNNNNNCTT	2 cut(s)	72, 104
FaqI	GGGAC	1 cut(s)	180
FatI	CATG	1 cut(s)	148
FbaI	TGATCA	1 cut(s)	15
FokI	GGATG	1 cut(s)	113
FspBI	CTAG	1 cut(s)	137
HgaI	GACGC	1 cut(s)	182
Hin1II	CATG	1 cut(s)	152
HinfI	GANTC	2 cut(s)	26, 198
Hpy188I	TCNGA	1 cut(s)	205
HpyAV	CCTTC	2 cut(s)	164, 200
HpyCH4V	TGCA	1 cut(s)	4
HpyF10VI	GCNNNNNNNGC	1 cut(s)	311
HpyF3I	CTNAG	2 cut(s)	24, 202
Hsp92II	CATG	1 cut(s)	152
Ksp22I	TGATCA	1 cut(s)	15
Kzo9I	GATC	2 cut(s)	15, 324
LpnPI	CCDG	5 cut(s)	60, 120, 148, 175, 204
MaeI	CTAG	1 cut(s)	137
MalI	GATC	2 cut(s)	17, 326
MboI	GATC	2 cut(s)	15, 324
MhlI	GDGCHC	1 cut(s)	284
MluCI	AATT	1 cut(s)	271
MlyI	GAGTC	1 cut(s)	35
MseI	TTAA	3 cut(s)	32, 84, 122
MspCI	CTTAAG	1 cut(s)	31
MspR9I	CCNGG	1 cut(s)	163
MvaI	CCWGG	1 cut(s)	163
MwoI	GCNNNNNNNGC	1 cut(s)	311
NdeII	GATC	2 cut(s)	15, 324
NlaIII	CATG	1 cut(s)	152
PfeI	GAWTC	1 cut(s)	198
PleI	GAGTC	1 cut(s)	34
PpsI	GAGTC	1 cut(s)	34
Psp6I	CCWGG	1 cut(s)	161
PspGI	CCWGG	1 cut(s)	161
RsaI	GTAC	1 cut(s)	141
RsaNI	GTAC	1 cut(s)	140
SaqAI	TTAA	3 cut(s)	32, 84, 122
Sau3AI	GATC	2 cut(s)	15, 324
ScaI	AGTACT	1 cut(s)	141
SchI	GAGTC	1 cut(s)	35
ScrFI	CCNGG	1 cut(s)	163
SduI	GDGCHC	1 cut(s)	284
SetI	ASST	4 cut(s)	99, 156, 223, 241
SfcI	CTRYAG	1 cut(s)	329
SmlI	CTYRAG	1 cut(s)	31
SmoI	CTYRAG	1 cut(s)	31
Sse9I	AATT	1 cut(s)	271
SspMI	CTAG	1 cut(s)	137
StyD4I	CCNGG	1 cut(s)	161
StyI	CCWWGG	1 cut(s)	62
TasI	AATT	1 cut(s)	271
TatI	WGTACW	1 cut(s)	139
TfiI	GAWTC	1 cut(s)	198
Tru1I	TTAA	3 cut(s)	32, 84, 122
Tru9I	TTAA	3 cut(s)	32, 84, 122
TscAI	CASTG	1 cut(s)	28
TspRI	CASTG	1 cut(s)	28
Vha464I	CTTAAG	1 cut(s)	31
XspI	CTAG	1 cut(s)	137
ZrmI	AGTACT	1 cut(s)	141

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.