Rmu_sc0004112.1_g000024

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004112.1
OG0021652
Physical Location & Seq
Forward (+)
93848 .. 94183
336 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004112.1_g000024.1.cds

Sequence Viewer

Length: 336 bp
atgggcctcactggaagaaagatttggcaagtccgtgactccctgctttcggacttagaagtgagatggcatagcctccgcttctgtgattgcaagtcagttcttgactacaactcggaagtactttgcattaaatccttaatggaattctgtggtaaagagatcacagattcgatgttgattgagaagactctctctaccttccccatctctgcattgatggttgctaagaactatcgaatcgatgttactgcaggacggatcacaaggtttcatgagctcattggagctatgaatgtcactgaaaagcatgacaacatccttgctataatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

111

Amino Acids

12.71

Weight (kDa)

6.81

Isoelectric Point (pI)

34.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AclWI GGATC 1 cut(s) 269
AcsI RAATTY 1 cut(s) 146
AfaI GTAC 1 cut(s) 123
AfiI CCNNNNNNNGG 1 cut(s) 49
AjuI GAANNNNNNNTTGG 2 cut(s) 7, 39
AluBI AGCT 2 cut(s) 280, 290
AluI AGCT 2 cut(s) 280, 290
Alw21I GWGCWC 1 cut(s) 282
AlwI GGATC 1 cut(s) 269
AoxI GGCC 1 cut(s) 4
ApoI RAATTY 1 cut(s) 146
AspS9I GGNCC 1 cut(s) 4
BanII GRGCYC 1 cut(s) 282
BbsI GAAGAC 1 cut(s) 194
Bbv12I GWGCWC 1 cut(s) 282
BccI CCATC 3 cut(s) 60, 214, 215
BcgI CGANNNNNNTGC 2 cut(s) 233, 267
BfmI CTRYAG 1 cut(s) 252
BmcAI AGTACT 1 cut(s) 123
BmgT120I GGNCC 1 cut(s) 4
BpiI GAAGAC 1 cut(s) 194
Bsa29I ATCGAT 1 cut(s) 243
Bsc4I CCNNNNNNNGG 1 cut(s) 49
Bse1I ACTGG 1 cut(s) 16
BseCI ATCGAT 1 cut(s) 243
BseGI GGATG 1 cut(s) 318
BseLI CCNNNNNNNGG 1 cut(s) 49
BseNI ACTGG 1 cut(s) 16
BshFI GGCC 1 cut(s) 6
BshVI ATCGAT 1 cut(s) 243
BsiHKAI GWGCWC 1 cut(s) 282
BslI CCNNNNNNNGG 1 cut(s) 49
BsnI GGCC 1 cut(s) 6
Bsp1286I GDGCHC 1 cut(s) 282
Bsp143I GATC 2 cut(s) 162, 261
BspACI CCGC 1 cut(s) 79
BspANI GGCC 1 cut(s) 6
BspDI ATCGAT 1 cut(s) 243
BspHI TCATGA 1 cut(s) 274
BspMAI CTGCAG 1 cut(s) 256
BspPI GGATC 1 cut(s) 269
BsrI ACTGG 1 cut(s) 16
BssMI GATC 2 cut(s) 162, 261
BstDEI CTNAG 2 cut(s) 55, 228
BstF5I GGATG 1 cut(s) 318
BstKTI GATC 2 cut(s) 165, 264
BstMBI GATC 2 cut(s) 162, 261
BstSFI CTRYAG 1 cut(s) 252
BstV2I GAAGAC 1 cut(s) 194
Bsu15I ATCGAT 1 cut(s) 243
BsuRI GGCC 1 cut(s) 6
BsuTUI ATCGAT 1 cut(s) 243
BtsCI GGATG 1 cut(s) 318
BtsIMutI CAGTG 2 cut(s) 9, 300
CciI TCATGA 1 cut(s) 274
Cfr13I GGNCC 1 cut(s) 4
ClaI ATCGAT 1 cut(s) 243
Csp6I GTAC 1 cut(s) 122
CviAII CATG 2 cut(s) 275, 311
CviJI RGCY 4 cut(s) 6, 75, 280, 290
CviKI_1 RGCY 4 cut(s) 6, 75, 280, 290
CviQI GTAC 1 cut(s) 122
DdeI CTNAG 2 cut(s) 55, 228
DpnI GATC 2 cut(s) 164, 263
DpnII GATC 2 cut(s) 162, 261
Ecl136II GAGCTC 1 cut(s) 280
Eco24I GRGCYC 1 cut(s) 282
Eco53kI GAGCTC 1 cut(s) 280
EcoICRI GAGCTC 1 cut(s) 280
EcoRI GAATTC 1 cut(s) 146
EcoT38I GRGCYC 1 cut(s) 282
FaeI CATG 2 cut(s) 278, 314
FaiI YATR 5 cut(s) 72, 276, 293, 312, 329
FatI CATG 2 cut(s) 274, 310
FokI GGATG 1 cut(s) 305
FriOI GRGCYC 1 cut(s) 282
HaeIII GGCC 1 cut(s) 6
Hin1II CATG 2 cut(s) 278, 314
HinfI GANTC 4 cut(s) 38, 170, 190, 240
Hpy188I TCNGA 2 cut(s) 52, 118
Hpy188III TCNNGA 2 cut(s) 104, 275
HpyAV CCTTC 1 cut(s) 211
HpyCH4V TGCA 4 cut(s) 93, 129, 215, 254
HpyF3I CTNAG 2 cut(s) 55, 228
Hsp92II CATG 2 cut(s) 278, 314
Kzo9I GATC 2 cut(s) 162, 261
LmnI GCTCC 1 cut(s) 287
LpnPI CCDG 2 cut(s) 56, 240
MaeIII GTNAC 3 cut(s) 35, 247, 298
MalI GATC 2 cut(s) 164, 263
MboI GATC 2 cut(s) 162, 261
MboII GAAGA 2 cut(s) 27, 199
MhlI GDGCHC 1 cut(s) 282
MluCI AATT 2 cut(s) 146, 330
MlyI GAGTC 2 cut(s) 32, 184
MnlI CCTC 2 cut(s) 17, 86
MseI TTAA 2 cut(s) 132, 140
NdeII GATC 2 cut(s) 162, 261
NlaIII CATG 2 cut(s) 278, 314
NmuCI GTSAC 2 cut(s) 35, 298
PagI TCATGA 1 cut(s) 274
PfeI GAWTC 2 cut(s) 170, 240
PleI GAGTC 2 cut(s) 32, 184
PpsI GAGTC 2 cut(s) 32, 184
Psp124BI GAGCTC 1 cut(s) 282
PspPI GGNCC 1 cut(s) 4
PstI CTGCAG 1 cut(s) 256
RsaI GTAC 1 cut(s) 123
RsaNI GTAC 1 cut(s) 122
SacI GAGCTC 1 cut(s) 282
SaqAI TTAA 2 cut(s) 132, 140
Sau3AI GATC 2 cut(s) 162, 261
Sau96I GGNCC 1 cut(s) 4
ScaI AGTACT 1 cut(s) 123
SchI GAGTC 2 cut(s) 32, 184
SduI GDGCHC 1 cut(s) 282
SetI ASST 4 cut(s) 203, 272, 282, 292
SfcI CTRYAG 1 cut(s) 252
Sse9I AATT 2 cut(s) 146, 330
SsiI CCGC 1 cut(s) 79
SstI GAGCTC 1 cut(s) 282
TaqI TCGA 3 cut(s) 173, 238, 243
TasI AATT 2 cut(s) 146, 330
TatI WGTACW 1 cut(s) 121
TfiI GAWTC 2 cut(s) 170, 240
Tru1I TTAA 2 cut(s) 132, 140
Tru9I TTAA 2 cut(s) 132, 140
TscAI CASTG 2 cut(s) 16, 307
TseFI GTSAC 2 cut(s) 35, 298
Tsp45I GTSAC 2 cut(s) 35, 298
TspDTI ATGAA 2 cut(s) 263, 308
TspGWI ACGGA 2 cut(s) 23, 274
TspRI CASTG 2 cut(s) 16, 307
XapI RAATTY 1 cut(s) 146
ZrmI AGTACT 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.