Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004125.1

Orthogroup ID

OG0025577

Physical Location & Seq

Genomic Coordinates Forward (+)

81589 .. 82800

Gene Structure 1212 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 303 bp

atgggtctcgatctgggtgttgacacagaggcgaggcagtatatgatggtggggtgtgtgaggaattcggattcagatgaggtgtttcggctttacgaggagttgaaggagaagttagaaggggaggtggaggatggagttgtgaagatcgatatgggtctcgatctgggtgttgacacagaggcgaggcagtatatgatggtggggtgtgtgaggaattcggattcagatgaggtgtttcggctttacgaggagttgaaggagaagttagaaggggaggtggaggatggagttgtggtttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0000166 GO:0003006 GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005524 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0006139 GO:0006349 GO:0006725 GO:0006807 GO:0007275 GO:0008144 GO:0008150 GO:0008152 GO:0009451 GO:0009507 GO:0009536 GO:0009790 GO:0009791 GO:0009793 GO:0009888 GO:0009960 GO:0009987 GO:0010154 GO:0010468 GO:0016070 GO:0016787 GO:0016788 GO:0017076 GO:0019222 GO:0022414 GO:0030554 GO:0032501 GO:0032502 GO:0032553 GO:0032555 GO:0032559 GO:0034641 GO:0035639 GO:0036094 GO:0040029 GO:0043167 GO:0043168 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0046483 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0050789 GO:0060255 GO:0061458 GO:0065007 GO:0071514 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:0097367 GO:1901265 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_2 PPR_3

Protein Analysis

100

Amino Acids

11.35

Weight (kDa)

4.13

Isoelectric Point (pI)

24.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025577)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0004125.1_g000013 Rmu_sc0009764.1_g000001
rosa_roxburghii	Rroxscaffold_3G00257800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	64, 217
AgsI	TTSAA	2 cut(s)	106, 259
Alw26I	GTCTC	2 cut(s)	11, 164
ApoI	RAATTY	2 cut(s)	64, 217
BccI	CCATC	4 cut(s)	40, 128, 193, 281
BcoDI	GTCTC	2 cut(s)	11, 164
Bsa29I	ATCGAT	1 cut(s)	150
BsaI	GGTCTC	2 cut(s)	11, 164
BsaXI	ACNNNNNCTCC	1 cut(s)	282
BseCI	ATCGAT	1 cut(s)	150
BseGI	GGATG	2 cut(s)	139, 292
BseRI	GAGGAG	2 cut(s)	113, 266
BshVI	ATCGAT	1 cut(s)	150
BsmAI	GTCTC	2 cut(s)	11, 164
Bso31I	GGTCTC	2 cut(s)	11, 164
Bsp143I	GATC	3 cut(s)	10, 147, 163
BspDI	ATCGAT	1 cut(s)	150
BspTNI	GGTCTC	2 cut(s)	11, 164
BssMI	GATC	3 cut(s)	10, 147, 163
BstF5I	GGATG	2 cut(s)	139, 292
BstKTI	GATC	3 cut(s)	13, 150, 166
BstMAI	GTCTC	2 cut(s)	11, 164
BstMBI	GATC	3 cut(s)	10, 147, 163
Bsu15I	ATCGAT	1 cut(s)	150
BsuTUI	ATCGAT	1 cut(s)	150
BtsCI	GGATG	2 cut(s)	139, 292
ClaI	ATCGAT	1 cut(s)	150
CviJI	RGCY	2 cut(s)	91, 244
CviKI_1	RGCY	2 cut(s)	91, 244
DpnI	GATC	3 cut(s)	12, 149, 165
DpnII	GATC	3 cut(s)	10, 147, 163
Eco31I	GGTCTC	2 cut(s)	11, 164
EcoRI	GAATTC	2 cut(s)	64, 217
FaiI	YATR	5 cut(s)	42, 44, 155, 195, 197
FokI	GGATG	2 cut(s)	146, 299
HincII	GTYRAC	2 cut(s)	22, 175
HindII	GTYRAC	2 cut(s)	22, 175
HinfI	GANTC	2 cut(s)	71, 224
Hpy166II	GTNNAC	2 cut(s)	22, 175
Hpy188I	TCNGA	4 cut(s)	70, 76, 223, 229
Hpy188III	TCNNGA	2 cut(s)	8, 161
Hpy8I	GTNNAC	2 cut(s)	22, 175
HpyAV	CCTTC	4 cut(s)	100, 113, 253, 266
Kzo9I	GATC	3 cut(s)	10, 147, 163
LpnPI	CCDG	1 cut(s)	152
MalI	GATC	3 cut(s)	12, 149, 165
MboI	GATC	3 cut(s)	10, 147, 163
MboII	GAAGA	1 cut(s)	157
MluCI	AATT	2 cut(s)	64, 217
NdeII	GATC	3 cut(s)	10, 147, 163
PfeI	GAWTC	2 cut(s)	71, 224
Sau3AI	GATC	3 cut(s)	10, 147, 163
SetI	ASST	4 cut(s)	84, 129, 237, 282
SgeI	CNNG	8 cut(s)	20, 26, 45, 109, 173, 179, 198, 262
Sse9I	AATT	2 cut(s)	64, 217
TaqI	TCGA	3 cut(s)	9, 150, 162
TasI	AATT	2 cut(s)	64, 217
TfiI	GAWTC	2 cut(s)	71, 224
XapI	RAATTY	2 cut(s)	64, 217

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.