Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004500.1

Orthogroup ID

OG0031309

Physical Location & Seq

Genomic Coordinates Reverse (-)

38082 .. 39648

Gene Structure 1567 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004500.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 357 bp

atggcagctaaatttctacctttcatctatggtagctttgcaggcgtgttcttcctagtgggtgttgacgacaacaggaggcagagttggagaagaaacttcatcaattccaaatcacaatgccgccccattcgtcatggtcatcatggccgacgacgatgcaccaacgtctgggatttccgggtcgccgacgctttcaacatgttaagcaagtgcttggagtggaggaaagagttcgaaacagatggcatcgtcgaggaagacctgggatctaataagctcaaaggtgttgtggcatatatgcatgggtttgataggtcggagatggccgcagatggccaggaagctttaccatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CRAL_TRIO CRAL_TRIO_N

Protein Analysis

118

Amino Acids

13.65

Weight (kDa)

8.93

Isoelectric Point (pI)

58.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031309)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0004500.1_g000007
rosa_roxburghii	Rroxscaffold_7G00195960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	171
AciI	CCGC	2 cut(s)	124, 330
AclWI	GGATC	1 cut(s)	277
AcoI	YGGCCR	3 cut(s)	148, 327, 337
AcsI	RAATTY	1 cut(s)	11
AfiI	CCNNNNNNNGG	1 cut(s)	171
AflIII	ACRYGT	1 cut(s)	201
AgsI	TTSAA	1 cut(s)	199
AjnI	CCWGG	2 cut(s)	264, 339
AluBI	AGCT	4 cut(s)	8, 36, 280, 347
AluI	AGCT	4 cut(s)	8, 36, 280, 347
AlwI	GGATC	1 cut(s)	277
AoxI	GGCC	3 cut(s)	148, 327, 337
ApeKI	GCWGC	1 cut(s)	5
ApoI	RAATTY	1 cut(s)	11
Asp700I	GAANNNNTTC	1 cut(s)	233
AsuC2I	CCSGG	1 cut(s)	182
AsuII	TTCGAA	1 cut(s)	237
BalI	TGGCCA	1 cut(s)	339
BbsI	GAAGAC	1 cut(s)	267
BbvI	GCAGC	1 cut(s)	17
BccI	CCATC	3 cut(s)	239, 319, 329
BcgI	CGANNNNNNTGC	2 cut(s)	141, 175
BciT130I	CCWGG	2 cut(s)	266, 341
BcnI	CCSGG	1 cut(s)	182
BfaI	CTAG	1 cut(s)	56
BisI	GCNGC	3 cut(s)	6, 124, 330
BlsI	GCNGC	3 cut(s)	7, 125, 331
Bme1390I	CCNGG	3 cut(s)	182, 266, 341
BmrFI	CCNGG	3 cut(s)	182, 266, 341
BmsI	GCATC	2 cut(s)	149, 258
BpiI	GAAGAC	1 cut(s)	267
Bpu14I	TTCGAA	1 cut(s)	237
BpuMI	CCSGG	1 cut(s)	182
BsaJI	CCNNGG	1 cut(s)	265
BsaXI	ACNNNNNCTCC	2 cut(s)	70, 100
Bsc4I	CCNNNNNNNGG	1 cut(s)	171
BseBI	CCWGG	2 cut(s)	266, 341
BseDI	CCNNGG	1 cut(s)	265
BseLI	CCNNNNNNNGG	1 cut(s)	171
BseXI	GCAGC	1 cut(s)	17
BshFI	GGCC	3 cut(s)	150, 329, 339
BsiSI	CCGG	1 cut(s)	181
BslI	CCNNNNNNNGG	1 cut(s)	171
BsnI	GGCC	3 cut(s)	150, 329, 339
Bsp119I	TTCGAA	1 cut(s)	237
Bsp143I	GATC	1 cut(s)	269
BspACI	CCGC	2 cut(s)	124, 330
BspANI	GGCC	3 cut(s)	150, 329, 339
BspPI	GGATC	1 cut(s)	277
BspT104I	TTCGAA	1 cut(s)	237
BssECI	CCNNGG	1 cut(s)	265
BssMI	GATC	1 cut(s)	269
Bst2UI	CCWGG	2 cut(s)	266, 341
BstBI	TTCGAA	1 cut(s)	237
BstC8I	GCNNGC	1 cut(s)	43
BstKTI	GATC	1 cut(s)	272
BstMBI	GATC	1 cut(s)	269
BstMWI	GCNNNNNNNGC	1 cut(s)	42
BstNI	CCWGG	2 cut(s)	266, 341
BstNSI	RCATGY	1 cut(s)	205
BstSCI	CCNGG	3 cut(s)	180, 264, 339
BstV1I	GCAGC	1 cut(s)	17
BstV2I	GAAGAC	1 cut(s)	267
BstX2I	RGATCY	1 cut(s)	269
BstYI	RGATCY	1 cut(s)	269
BsuRI	GGCC	3 cut(s)	150, 329, 339
Cac8I	GCNNGC	1 cut(s)	43
CseI	GACGC	1 cut(s)	200
CviAII	CATG	5 cut(s)	137, 146, 202, 305, 354
CviJI	RGCY	7 cut(s)	8, 36, 150, 280, 329, 339, 347
CviKI_1	RGCY	7 cut(s)	8, 36, 150, 280, 329, 339, 347
DpnI	GATC	1 cut(s)	271
DpnII	GATC	1 cut(s)	269
EaeI	YGGCCR	3 cut(s)	148, 327, 337
EcoRII	CCWGG	2 cut(s)	264, 339
EcoT22I	ATGCAT	1 cut(s)	306
FaeI	CATG	5 cut(s)	140, 149, 205, 308, 357
FaiI	YATR	9 cut(s)	30, 138, 147, 203, 298, 300, 302, 306, 355
FatI	CATG	5 cut(s)	136, 145, 201, 304, 353
Fnu4HI	GCNGC	3 cut(s)	6, 124, 330
Fsp4HI	GCNGC	3 cut(s)	6, 124, 330
FspBI	CTAG	1 cut(s)	56
GluI	GCNGC	3 cut(s)	6, 124, 330
HaeIII	GGCC	3 cut(s)	150, 329, 339
HapII	CCGG	1 cut(s)	181
HgaI	GACGC	1 cut(s)	200
Hin1II	CATG	5 cut(s)	140, 149, 205, 308, 357
HincII	GTYRAC	1 cut(s)	67
HindII	GTYRAC	1 cut(s)	67
HindIII	AAGCTT	1 cut(s)	345
HpaII	CCGG	1 cut(s)	181
Hpy166II	GTNNAC	1 cut(s)	67
Hpy188I	TCNGA	1 cut(s)	322
Hpy8I	GTNNAC	1 cut(s)	67
Hpy99I	CGWCG	4 cut(s)	156, 159, 194, 257
HpyCH4IV	ACGT	1 cut(s)	168
HpyCH4V	TGCA	3 cut(s)	41, 162, 304
HpyF10VI	GCNNNNNNNGC	1 cut(s)	42
HpySE526I	ACGT	1 cut(s)	168
Hsp92II	CATG	5 cut(s)	140, 149, 205, 308, 357
Kzo9I	GATC	1 cut(s)	269
LpnPI	CCDG	8 cut(s)	27, 61, 157, 194, 251, 278, 326, 353
Lsp1109I	GCAGC	1 cut(s)	17
LweI	GCATC	2 cut(s)	149, 258
MaeI	CTAG	1 cut(s)	56
MaeII	ACGT	1 cut(s)	168
MalI	GATC	1 cut(s)	271
MboI	GATC	1 cut(s)	269
MboII	GAAGA	3 cut(s)	43, 105, 272
MflI	RGATCY	1 cut(s)	269
MlsI	TGGCCA	1 cut(s)	339
MluCI	AATT	2 cut(s)	11, 106
MluNI	TGGCCA	1 cut(s)	339
MmeI	TCCRAC	2 cut(s)	68, 300
MnlI	CCTC	3 cut(s)	72, 219, 250
Mox20I	TGGCCA	1 cut(s)	339
Mph1103I	ATGCAT	1 cut(s)	306
MroXI	GAANNNNTTC	1 cut(s)	233
MscI	TGGCCA	1 cut(s)	339
MseI	TTAA	1 cut(s)	206
Msp20I	TGGCCA	1 cut(s)	339
MspI	CCGG	1 cut(s)	181
MspR9I	CCNGG	3 cut(s)	182, 266, 341
MvaI	CCWGG	2 cut(s)	266, 341
MwoI	GCNNNNNNNGC	1 cut(s)	42
NciI	CCSGG	1 cut(s)	182
NdeII	GATC	1 cut(s)	269
NlaIII	CATG	5 cut(s)	140, 149, 205, 308, 357
NsiI	ATGCAT	1 cut(s)	306
NspI	RCATGY	1 cut(s)	205
NspV	TTCGAA	1 cut(s)	237
PciI	ACATGT	1 cut(s)	201
PdmI	GAANNNNTTC	1 cut(s)	233
PflMI	CCANNNNNTGG	1 cut(s)	171
PkrI	GCNGC	3 cut(s)	7, 125, 331
PscI	ACATGT	1 cut(s)	201
Psp6I	CCWGG	2 cut(s)	264, 339
PspGI	CCWGG	2 cut(s)	264, 339
PsuI	RGATCY	1 cut(s)	269
SaqAI	TTAA	1 cut(s)	206
SatI	GCNGC	3 cut(s)	6, 124, 330
Sau3AI	GATC	1 cut(s)	269
ScrFI	CCNGG	3 cut(s)	182, 266, 341
SetI	ASST	9 cut(s)	10, 22, 38, 171, 267, 282, 289, 320, 349
SfaNI	GCATC	2 cut(s)	149, 258
SfuI	TTCGAA	1 cut(s)	237
Sse9I	AATT	2 cut(s)	11, 106
SsiI	CCGC	2 cut(s)	124, 330
SspMI	CTAG	1 cut(s)	56
StyD4I	CCNGG	3 cut(s)	180, 264, 339
TaiI	ACGT	1 cut(s)	171
TaqI	TCGA	2 cut(s)	237, 255
TasI	AATT	2 cut(s)	11, 106
TauI	GCSGC	2 cut(s)	126, 332
Tru1I	TTAA	1 cut(s)	206
Tru9I	TTAA	1 cut(s)	206
TseI	GCWGC	1 cut(s)	5
TspDTI	ATGAA	2 cut(s)	13, 91
Van91I	CCANNNNNTGG	1 cut(s)	171
XapI	RAATTY	1 cut(s)	11
XceI	RCATGY	1 cut(s)	205
XmnI	GAANNNNTTC	1 cut(s)	233
XspI	CTAG	1 cut(s)	56
Zsp2I	ATGCAT	1 cut(s)	306

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.