Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004831.1

Orthogroup ID

OG0031320

Physical Location & Seq

Genomic Coordinates Reverse (-)

53186 .. 53695

Gene Structure 510 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004831.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 510 bp

atgcaggaaagagaacaggcactgagatcattcaagagtggacatacaccaattttagtggcaacagatgtggctgcacgtggtctggacattccccatgtagctcacgtggtaaattttgatcttccaaatgacattgatgattatgttcaccggataggtcggacagggcgagctggaaaatcaggacttgcaacagcattctttaatgagaacaacctttcgatggcaaaaccactagctgatctaatgcaagaagcaaatcaggaagtgcctgcttggattactcgatacgcatcgagggcttcttatggtggtggtagaaaccggcgatctgggggaggccgttttggtggccgtgacttcagaagggagaattcttttaacaggggttcagatttctatggagggggaaataatggcggtggatatggtggcggcggctatggtggcggcggctatggtggtgggggttatggcggtggtactggtcctagtgcttgggactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003724 GO:0003729 GO:0003824 GO:0004004 GO:0004386 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0005737 GO:0005777 GO:0005886 GO:0006139 GO:0006725 GO:0006807 GO:0008026 GO:0008150 GO:0008152 GO:0008186 GO:0009987 GO:0010501 GO:0016020 GO:0016070 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0031974 GO:0031981 GO:0034641 GO:0042579 GO:0042623 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044237 GO:0044238 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044446 GO:0044464 GO:0046483 GO:0070013 GO:0070035 GO:0071704 GO:0071944 GO:0090304 GO:0097159 GO:0140098 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

ko04622 ko05161 ko05203 map04622 map05161 map05203

Pfam Domains

Protein Families

DEAD Helicase_C

Protein Analysis

169

Amino Acids

17.79

Weight (kDa)

9.34

Isoelectric Point (pI)

38.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031320)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_co8064520.1_g000001 Rmu_sc0004831.1_g000012

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	6 cut(s)	423, 438, 441, 453, 456, 480
AcoI	YGGCCR	1 cut(s)	355
AcsI	RAATTY	2 cut(s)	115, 376
AcuI	CTGAAG	1 cut(s)	349
AcvI	CACGTG	2 cut(s)	80, 109
AfaI	GTAC	1 cut(s)	487
AfiI	CCNNNNNNNGG	1 cut(s)	226
AgsI	TTSAA	1 cut(s)	34
AluBI	AGCT	3 cut(s)	104, 176, 242
AluI	AGCT	3 cut(s)	104, 176, 242
AlwNI	CAGNNNCTG	1 cut(s)	22
AoxI	GGCC	2 cut(s)	343, 355
ApeKI	GCWGC	1 cut(s)	74
ApoI	RAATTY	2 cut(s)	115, 376
AspS9I	GGNCC	1 cut(s)	491
AsuHPI	GGTGA	1 cut(s)	143
AvaII	GGWCC	1 cut(s)	491
BbrPI	CACGTG	2 cut(s)	80, 109
BbvI	GCAGC	1 cut(s)	61
BccI	CCATC	1 cut(s)	220
BceAI	ACGGC	2 cut(s)	330, 342
BfaI	CTAG	3 cut(s)	239, 495, 508
BisI	GCNGC	5 cut(s)	75, 439, 442, 454, 457
BlsI	GCNGC	5 cut(s)	76, 440, 443, 455, 458
Bme18I	GGWCC	1 cut(s)	491
BmgT120I	GGNCC	1 cut(s)	491
BmsI	GCATC	1 cut(s)	305
BsaAI	YACGTR	2 cut(s)	80, 109
BsaBI	GATNNNNATC	1 cut(s)	295
BsaWI	WCCGGW	1 cut(s)	153
Bsc4I	CCNNNNNNNGG	1 cut(s)	226
Bse118I	RCCGGY	1 cut(s)	327
Bse1I	ACTGG	1 cut(s)	493
Bse8I	GATNNNNATC	1 cut(s)	295
BseJI	GATNNNNATC	1 cut(s)	295
BseLI	CCNNNNNNNGG	1 cut(s)	226
BseMII	CTCAG	1 cut(s)	14
BseNI	ACTGG	1 cut(s)	493
BseXI	GCAGC	1 cut(s)	61
BsgI	GTGCAG	1 cut(s)	60
BshFI	GGCC	2 cut(s)	345, 357
BsiSI	CCGG	2 cut(s)	154, 328
BslI	CCNNNNNNNGG	1 cut(s)	226
BsmI	GAATGC	1 cut(s)	200
BsnI	GGCC	2 cut(s)	345, 357
Bsp143I	GATC	4 cut(s)	26, 121, 244, 332
BspACI	CCGC	6 cut(s)	423, 438, 441, 453, 456, 480
BspANI	GGCC	2 cut(s)	345, 357
BspCNI	CTCAG	1 cut(s)	15
BsrFI	RCCGGY	1 cut(s)	327
BsrI	ACTGG	1 cut(s)	493
BssAI	RCCGGY	1 cut(s)	327
BssMI	GATC	4 cut(s)	26, 121, 244, 332
BstBAI	YACGTR	2 cut(s)	80, 109
BstC8I	GCNNGC	2 cut(s)	174, 276
BstDEI	CTNAG	1 cut(s)	23
BstKTI	GATC	4 cut(s)	29, 124, 247, 335
BstMBI	GATC	4 cut(s)	26, 121, 244, 332
BstMWI	GCNNNNNNNGC	2 cut(s)	302, 450
BstV1I	GCAGC	1 cut(s)	61
BsuRI	GGCC	2 cut(s)	345, 357
BtsIMutI	CAGTG	1 cut(s)	20
Cac8I	GCNNGC	2 cut(s)	174, 276
CaiI	CAGNNNCTG	1 cut(s)	22
Cfr10I	RCCGGY	1 cut(s)	327
Cfr13I	GGNCC	1 cut(s)	491
Csp6I	GTAC	1 cut(s)	486
CspCI	CAANNNNNGTGG	4 cut(s)	39, 51, 74, 86
CviAII	CATG	1 cut(s)	98
CviJI	RGCY	9 cut(s)	74, 104, 176, 242, 305, 345, 357, 444, 459
CviKI_1	RGCY	9 cut(s)	74, 104, 176, 242, 305, 345, 357, 444, 459
CviQI	GTAC	1 cut(s)	486
DdeI	CTNAG	1 cut(s)	23
DpnI	GATC	4 cut(s)	28, 123, 246, 334
DpnII	GATC	4 cut(s)	26, 121, 244, 332
EaeI	YGGCCR	1 cut(s)	355
Eco47I	GGWCC	1 cut(s)	491
Eco57I	CTGAAG	1 cut(s)	349
Eco72I	CACGTG	2 cut(s)	80, 109
EcoRI	GAATTC	1 cut(s)	376
FaeI	CATG	1 cut(s)	101
FaiI	YATR	9 cut(s)	45, 99, 147, 312, 405, 432, 447, 462, 477
FatI	CATG	1 cut(s)	97
Fnu4HI	GCNGC	5 cut(s)	75, 439, 442, 454, 457
Fsp4HI	GCNGC	5 cut(s)	75, 439, 442, 454, 457
FspBI	CTAG	3 cut(s)	239, 495, 508
GluI	GCNGC	5 cut(s)	75, 439, 442, 454, 457
HaeIII	GGCC	2 cut(s)	345, 357
HapII	CCGG	2 cut(s)	154, 328
Hin1II	CATG	1 cut(s)	101
HpaII	CCGG	2 cut(s)	154, 328
HphI	GGTGA	1 cut(s)	143
Hpy166II	GTNNAC	2 cut(s)	41, 151
Hpy188I	TCNGA	3 cut(s)	165, 368, 397
Hpy188III	TCNNGA	4 cut(s)	34, 86, 186, 266
Hpy8I	GTNNAC	2 cut(s)	41, 151
HpyAV	CCTTC	1 cut(s)	363
HpyCH4IV	ACGT	2 cut(s)	79, 108
HpyCH4V	TGCA	4 cut(s)	4, 77, 194, 253
HpyF10VI	GCNNNNNNNGC	2 cut(s)	302, 450
HpyF3I	CTNAG	1 cut(s)	23
HpySE526I	ACGT	2 cut(s)	79, 108
Hsp92II	CATG	1 cut(s)	101
Kzo9I	GATC	4 cut(s)	26, 121, 244, 332
Lsp1109I	GCAGC	1 cut(s)	61
LweI	GCATC	1 cut(s)	305
MaeI	CTAG	3 cut(s)	239, 495, 508
MaeII	ACGT	2 cut(s)	79, 108
MaeIII	GTNAC	1 cut(s)	359
MalI	GATC	4 cut(s)	28, 123, 246, 334
MboI	GATC	4 cut(s)	26, 121, 244, 332
MboII	GAAGA	1 cut(s)	116
MluCI	AATT	3 cut(s)	51, 115, 376
MmeI	TCCRAC	1 cut(s)	143
MnlI	CCTC	3 cut(s)	294, 335, 401
MseI	TTAA	2 cut(s)	207, 384
MspI	CCGG	2 cut(s)	154, 328
Mva1269I	GAATGC	1 cut(s)	200
MwoI	GCNNNNNNNGC	2 cut(s)	302, 450
NdeII	GATC	4 cut(s)	26, 121, 244, 332
NlaIII	CATG	1 cut(s)	101
NmuCI	GTSAC	1 cut(s)	359
PcsI	WCGNNNNNNNCGW	1 cut(s)	169
PctI	GAATGC	1 cut(s)	200
PkrI	GCNGC	5 cut(s)	76, 440, 443, 455, 458
PmaCI	CACGTG	2 cut(s)	80, 109
PmlI	CACGTG	2 cut(s)	80, 109
Ppu21I	YACGTR	2 cut(s)	80, 109
PspCI	CACGTG	2 cut(s)	80, 109
PspPI	GGNCC	1 cut(s)	491
PstNI	CAGNNNCTG	1 cut(s)	22
RsaI	GTAC	1 cut(s)	487
RsaNI	GTAC	1 cut(s)	486
SaqAI	TTAA	2 cut(s)	207, 384
SatI	GCNGC	5 cut(s)	75, 439, 442, 454, 457
Sau3AI	GATC	4 cut(s)	26, 121, 244, 332
Sau96I	GGNCC	1 cut(s)	491
SetI	ASST	7 cut(s)	82, 106, 111, 163, 178, 222, 244
SfaNI	GCATC	1 cut(s)	305
SinI	GGWCC	1 cut(s)	491
Sse9I	AATT	3 cut(s)	51, 115, 376
SsiI	CCGC	6 cut(s)	423, 438, 441, 453, 456, 480
SspMI	CTAG	3 cut(s)	239, 495, 508
TaiI	ACGT	2 cut(s)	82, 111
TaqI	TCGA	3 cut(s)	224, 289, 299
TasI	AATT	3 cut(s)	51, 115, 376
TauI	GCSGC	4 cut(s)	441, 444, 456, 459
Tru1I	TTAA	2 cut(s)	207, 384
Tru9I	TTAA	2 cut(s)	207, 384
TscAI	CASTG	1 cut(s)	27
TseFI	GTSAC	1 cut(s)	359
TseI	GCWGC	1 cut(s)	74
Tsp45I	GTSAC	1 cut(s)	359
TspRI	CASTG	1 cut(s)	27
VpaK11BI	GGWCC	1 cut(s)	491
XapI	RAATTY	2 cut(s)	115, 376
XspI	CTAG	3 cut(s)	239, 495, 508

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.