Rmu_sc0005149.1_g000002

ADP binding

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005149.1
Physical Location & Seq
Reverse (-)
11236 .. 12099
864 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005149.1_g000002.1.cds

Sequence Viewer

Length: 864 bp
atgcatgatatgatgcaccaggttatcttatcaatagcttccaacagcaaagatggatttttggtaagatgcagggtgcacttggagggttggcccaatgttttgaggcaaccttacaaatccaggacactaactatcagtgaatctgagcttttattgttgtcatgcacggagaggtctgaaactatgccaccagccctaattttgaataaaattctggacctcaaggttgtagacatcaggagggctgatatgtcatcaatactattgtttattgtacttttgaaaagccttcaaacgctgcgtctggagcgttgcaatttggaaagtgtacatgttgatattggagagctacaggaactaatgatactcagcttttgtggttcttcaatggaacagttacctgctggtcttggaaagctgtcaaatctcagattgctagatgtgactaaatgtaaaagtccgcaaaggaatacagtggatgttgcttttatcccaagcttagcgaaactagaagaagtgtacatgaggaatagatgcttgcaatggggggttcaggagtcagagattgatactaactcacaactccaaaagcttctttcattaggttgtttgactgctttagaaatgattcttccaatgagaggcaatttgcagttctgcacaacatcctgccatttcatcagctccaaagatttaagatcttatttgattgctttagaaatgattcttccaatgagaggcaatctgcagttctgcacaacatcctgccatttcatcagctccaaagatttaagatctctacaacagatgtacctacctcccctatcatggctagtttgctatgtcaccaagcataaataa
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

287

Amino Acids

32.71

Weight (kDa)

8.43

Isoelectric Point (pI)

67.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031338)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0005149.1_g000002
rosa_samantha Rh6BG261500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 412
AccI GTMKAC 1 cut(s) 234
AciI CCGC 1 cut(s) 464
AcsI RAATTY 1 cut(s) 213
AfaI GTAC 4 cut(s) 279, 333, 524, 815
AfiI CCNNNNNNNGG 3 cut(s) 644, 740, 831
AflIII ACRYGT 1 cut(s) 334
AgsI TTSAA 4 cut(s) 208, 286, 296, 390
AjnI CCWGG 2 cut(s) 18, 122
AluBI AGCT 9 cut(s) 38, 151, 352, 375, 421, 501, 595, 687, 783
AluI AGCT 9 cut(s) 38, 151, 352, 375, 421, 501, 595, 687, 783
Alw21I GWGCWC 1 cut(s) 81
Alw44I GTGCAC 1 cut(s) 77
AoxI GGCC 1 cut(s) 92
ApaLI GTGCAC 1 cut(s) 77
ApeKI GCWGC 1 cut(s) 301
ApoI RAATTY 1 cut(s) 213
ArsI GACNNNNNNTTYG 2 cut(s) 289, 321
Asp700I GAANNNNTTC 2 cut(s) 630, 726
AspS9I GGNCC 2 cut(s) 93, 220
AsuHPI GGTGA 1 cut(s) 841
AvaII GGWCC 1 cut(s) 220
BaeGI GKGCMC 1 cut(s) 81
BaeI ACNNNNGTAYC 2 cut(s) 797, 830
Bbv12I GWGCWC 1 cut(s) 81
BbvI GCAGC 1 cut(s) 288
BccI CCATC 1 cut(s) 47
BciT130I CCWGG 2 cut(s) 20, 124
BfaI CTAG 3 cut(s) 440, 512, 836
BfmI CTRYAG 2 cut(s) 353, 749
BfuAI ACCTGC 1 cut(s) 412
BglII AGATCT 2 cut(s) 701, 797
BisI GCNGC 1 cut(s) 302
BlpI GCTNAGC 1 cut(s) 502
BlsI GCNGC 1 cut(s) 303
Bme1390I CCNGG 2 cut(s) 20, 124
Bme18I GGWCC 1 cut(s) 220
BmgT120I GGNCC 2 cut(s) 93, 220
BmrFI CCNGG 2 cut(s) 20, 124
BmsI GCATC 3 cut(s) 3, 59, 527
BpmI CTGGAG 1 cut(s) 329
Bpu1102I GCTNAGC 1 cut(s) 502
BpuEI CTTGAG 1 cut(s) 209
Bsc4I CCNNNNNNNGG 3 cut(s) 644, 740, 831
Bse3DI GCAATG 1 cut(s) 551
BseBI CCWGG 2 cut(s) 20, 124
BseGI GGATG 3 cut(s) 487, 668, 764
BseLI CCNNNNNNNGG 3 cut(s) 644, 740, 831
BseMI GCAATG 1 cut(s) 551
BseMII CTCAG 3 cut(s) 138, 385, 445
BseSI GKGCMC 1 cut(s) 81
BseXI GCAGC 1 cut(s) 288
BsgI GTGCAG 2 cut(s) 646, 742
BshFI GGCC 1 cut(s) 94
BsiHKAI GWGCWC 1 cut(s) 81
BslI CCNNNNNNNGG 3 cut(s) 644, 740, 831
BsnI GGCC 1 cut(s) 94
Bsp1286I GDGCHC 1 cut(s) 81
Bsp1407I TGTACA 2 cut(s) 331, 522
Bsp143I GATC 2 cut(s) 701, 797
Bsp1720I GCTNAGC 1 cut(s) 502
BspACI CCGC 1 cut(s) 464
BspANI GGCC 1 cut(s) 94
BspCNI CTCAG 3 cut(s) 139, 384, 444
BspMAI CTGCAG 1 cut(s) 753
BspMI ACCTGC 1 cut(s) 412
BsrDI GCAATG 1 cut(s) 551
BsrGI TGTACA 2 cut(s) 331, 522
BssMI GATC 2 cut(s) 701, 797
Bst2UI CCWGG 2 cut(s) 20, 124
Bst4CI ACNGT 2 cut(s) 399, 478
BstAUI TGTACA 2 cut(s) 331, 522
BstC8I GCNNGC 1 cut(s) 542
BstDEI CTNAG 4 cut(s) 147, 371, 431, 502
BstF5I GGATG 3 cut(s) 487, 668, 764
BstKTI GATC 2 cut(s) 704, 800
BstMBI GATC 2 cut(s) 701, 797
BstMWI GCNNNNNNNGC 1 cut(s) 310
BstNI CCWGG 2 cut(s) 20, 124
BstNSI RCATGY 1 cut(s) 338
BstSCI CCNGG 2 cut(s) 18, 122
BstSFI CTRYAG 2 cut(s) 353, 749
BstSLI GKGCMC 1 cut(s) 81
BstV1I GCAGC 1 cut(s) 288
BstX2I RGATCY 2 cut(s) 701, 797
BstYI RGATCY 2 cut(s) 701, 797
BsuRI GGCC 1 cut(s) 94
BtsCI GGATG 3 cut(s) 487, 668, 764
BtsIMutI CAGTG 2 cut(s) 145, 483
BveI ACCTGC 1 cut(s) 412
Cac8I GCNNGC 1 cut(s) 542
Cfr13I GGNCC 2 cut(s) 93, 220
CseI GACGC 1 cut(s) 293
CsiI ACCWGGT 1 cut(s) 18
Csp6I GTAC 4 cut(s) 278, 332, 523, 814
CviAII CATG 5 cut(s) 5, 165, 335, 526, 831
CviQI GTAC 4 cut(s) 278, 332, 523, 814
DdeI CTNAG 4 cut(s) 147, 371, 431, 502
DpnI GATC 2 cut(s) 703, 799
DpnII GATC 2 cut(s) 701, 797
Eco47I GGWCC 1 cut(s) 220
EcoRII CCWGG 2 cut(s) 18, 122
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 5 cut(s) 8, 168, 338, 529, 834
FatI CATG 5 cut(s) 4, 164, 334, 525, 830
FblI GTMKAC 1 cut(s) 234
Fnu4HI GCNGC 1 cut(s) 302
FokI GGATG 3 cut(s) 494, 655, 751
Fsp4HI GCNGC 1 cut(s) 302
FspBI CTAG 3 cut(s) 440, 512, 836
GluI GCNGC 1 cut(s) 302
GsuI CTGGAG 1 cut(s) 329
HaeIII GGCC 1 cut(s) 94
HgaI GACGC 1 cut(s) 293
Hin1II CATG 5 cut(s) 8, 168, 338, 529, 834
HindIII AAGCTT 2 cut(s) 499, 593
HinfI GANTC 4 cut(s) 143, 560, 631, 727
HphI GGTGA 1 cut(s) 841
Hpy166II GTNNAC 4 cut(s) 79, 235, 332, 523
Hpy188I TCNGA 4 cut(s) 148, 181, 434, 565
Hpy188III TCNNGA 4 cut(s) 218, 241, 308, 557
Hpy8I GTNNAC 4 cut(s) 79, 235, 332, 523
HpyAV CCTTC 1 cut(s) 302
HpyCH4III ACNGT 2 cut(s) 399, 478
HpyF10VI GCNNNNNNNGC 1 cut(s) 310
HpyF3I CTNAG 4 cut(s) 147, 371, 431, 502
Hsp92II CATG 5 cut(s) 8, 168, 338, 529, 834
Kzo9I GATC 2 cut(s) 701, 797
LmnI GCTCC 3 cut(s) 310, 692, 788
Lsp1109I GCAGC 1 cut(s) 288
LweI GCATC 3 cut(s) 3, 59, 527
MabI ACCWGGT 1 cut(s) 18
MaeI CTAG 3 cut(s) 440, 512, 836
MaeIII GTNAC 3 cut(s) 399, 445, 847
MalI GATC 2 cut(s) 703, 799
MboI GATC 2 cut(s) 701, 797
MboII GAAGA 4 cut(s) 378, 527, 626, 722
MflI RGATCY 2 cut(s) 701, 797
MhlI GDGCHC 1 cut(s) 81
MluCI AATT 4 cut(s) 201, 213, 319, 649
MlyI GAGTC 1 cut(s) 569
MmeI TCCRAC 1 cut(s) 66
MnlI CCTC 9 cut(s) 79, 99, 168, 233, 237, 522, 638, 734, 831
Mph1103I ATGCAT 1 cut(s) 6
MroXI GAANNNNTTC 2 cut(s) 630, 726
MseI TTAA 2 cut(s) 698, 794
MspR9I CCNGG 2 cut(s) 20, 124
MvaI CCWGG 2 cut(s) 20, 124
MwoI GCNNNNNNNGC 1 cut(s) 310
NdeII GATC 2 cut(s) 701, 797
NlaIII CATG 5 cut(s) 8, 168, 338, 529, 834
NmuCI GTSAC 2 cut(s) 445, 847
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 338
PciI ACATGT 1 cut(s) 334
PdmI GAANNNNTTC 2 cut(s) 630, 726
PfeI GAWTC 3 cut(s) 143, 631, 727
PfoI TCCNGGA 1 cut(s) 122
PkrI GCNGC 1 cut(s) 303
PleI GAGTC 1 cut(s) 568
PpsI GAGTC 1 cut(s) 568
PscI ACATGT 1 cut(s) 334
Psp6I CCWGG 2 cut(s) 18, 122
PspGI CCWGG 2 cut(s) 18, 122
PspPI GGNCC 2 cut(s) 93, 220
PsrI GAACNNNNNNTAC 2 cut(s) 351, 383
PstI CTGCAG 1 cut(s) 753
PsuI RGATCY 2 cut(s) 701, 797
RsaI GTAC 4 cut(s) 279, 333, 524, 815
RsaNI GTAC 4 cut(s) 278, 332, 523, 814
SaqAI TTAA 2 cut(s) 698, 794
SatI GCNGC 1 cut(s) 302
Sau3AI GATC 2 cut(s) 701, 797
Sau96I GGNCC 2 cut(s) 93, 220
SchI GAGTC 1 cut(s) 569
ScrFI CCNGG 2 cut(s) 20, 124
SduI GDGCHC 1 cut(s) 81
SexAI ACCWGGT 1 cut(s) 18
SfaNI GCATC 3 cut(s) 3, 59, 527
SfcI CTRYAG 2 cut(s) 353, 749
SinI GGWCC 1 cut(s) 220
SmlI CTYRAG 1 cut(s) 224
SmoI CTYRAG 1 cut(s) 224
Sse9I AATT 4 cut(s) 201, 213, 319, 649
SsiI CCGC 1 cut(s) 464
SspMI CTAG 3 cut(s) 440, 512, 836
StyD4I CCNGG 2 cut(s) 18, 122
TaaI ACNGT 2 cut(s) 399, 478
TasI AATT 4 cut(s) 201, 213, 319, 649
TatI WGTACW 3 cut(s) 277, 331, 522
TfiI GAWTC 3 cut(s) 143, 631, 727
Tru1I TTAA 2 cut(s) 698, 794
Tru9I TTAA 2 cut(s) 698, 794
TscAI CASTG 2 cut(s) 145, 483
TseFI GTSAC 2 cut(s) 445, 847
TseI GCWGC 1 cut(s) 301
Tsp45I GTSAC 2 cut(s) 445, 847
TspDTI ATGAA 3 cut(s) 591, 670, 766
TspGWI ACGGA 1 cut(s) 185
TspRI CASTG 2 cut(s) 145, 483
VneI GTGCAC 1 cut(s) 77
VpaK11BI GGWCC 1 cut(s) 220
XapI RAATTY 1 cut(s) 213
XceI RCATGY 1 cut(s) 338
XmiI GTMKAC 1 cut(s) 234
XmnI GAANNNNTTC 2 cut(s) 630, 726
XspI CTAG 3 cut(s) 440, 512, 836
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.