Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005347.1

Orthogroup ID

OG0031342

Physical Location & Seq

Genomic Coordinates Forward (+)

1304 .. 3930

Gene Structure 2627 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 441 bp

atgcatcagttcccagtttgtggaggttctaatgctgcttgggcatggcgtgtcagcggtgatctggcggcgagccgaggctcaggcggtagcctgcttggcggtgatttcgtaggtcataccattggcggtagttggtaccgctggtgtcgacatgagcgagattacagattcttggaatctagcacttgggttcccttttattcaaaaatggctacaatcatggagaagtatgcagcaggaagaccccatatggagaaaaattctggtgtaatggctgttaatttggaatgggaacttattgcccactatcttgatccagggttaccacttattccaagtgggatcaagattggaaattacctatactggggttcaattatctatccatacattatccacttcgatctggaacaacattctgcacacgccactacatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0012505 GO:0016020 GO:0016787 GO:0016788 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Str_synth

Protein Analysis

146

Amino Acids

16.39

Weight (kDa)

6.69

Isoelectric Point (pI)

35.8

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031342)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0005347.1_g000003
rosa_roxburghii	Rroxscaffold_2G00144650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	138
AccB1I	GGYRCC	1 cut(s)	138
AccB7I	CCANNNNNTGG	1 cut(s)	20
AccI	GTMKAC	1 cut(s)	151
AciI	CCGC	6 cut(s)	57, 68, 87, 102, 129, 142
AclWI	GGATC	2 cut(s)	311, 353
AcsI	RAATTY	1 cut(s)	262
AfaI	GTAC	1 cut(s)	140
AfiI	CCNNNNNNNGG	2 cut(s)	20, 370
AgsI	TTSAA	2 cut(s)	207, 378
AjnI	CCWGG	1 cut(s)	319
AlwI	GGATC	2 cut(s)	311, 353
ApeKI	GCWGC	2 cut(s)	35, 236
ApoI	RAATTY	1 cut(s)	262
Asp718I	GGTACC	1 cut(s)	138
AsuHPI	GGTGA	2 cut(s)	71, 116
BanI	GGYRCC	1 cut(s)	138
BbsI	GAAGAC	1 cut(s)	250
BbvI	GCAGC	2 cut(s)	22, 248
BciT130I	CCWGG	1 cut(s)	321
BfaI	CTAG	1 cut(s)	183
BglI	GCCNNNNNGGC	1 cut(s)	99
BisI	GCNGC	3 cut(s)	36, 69, 237
BlsI	GCNGC	3 cut(s)	37, 70, 238
Bme1390I	CCNGG	1 cut(s)	321
BmiI	GGNNCC	2 cut(s)	140, 195
BmrFI	CCNGG	1 cut(s)	321
BmrI	ACTGGG	2 cut(s)	8, 379
BmsI	GCATC	1 cut(s)	13
BmuI	ACTGGG	2 cut(s)	8, 379
BpiI	GAAGAC	1 cut(s)	250
Bpu10I	CCTNAGC	1 cut(s)	82
BsaJI	CCNNGG	2 cut(s)	76, 320
Bsc4I	CCNNNNNNNGG	2 cut(s)	20, 370
Bse1I	ACTGG	2 cut(s)	14, 374
BseBI	CCWGG	1 cut(s)	321
BseDI	CCNNGG	2 cut(s)	76, 320
BseLI	CCNNNNNNNGG	2 cut(s)	20, 370
BseMII	CTCAG	1 cut(s)	96
BseNI	ACTGG	2 cut(s)	14, 374
BseXI	GCAGC	2 cut(s)	22, 248
BsgI	GTGCAG	1 cut(s)	408
BshNI	GGYRCC	1 cut(s)	138
BslI	CCNNNNNNNGG	2 cut(s)	20, 370
Bsp143I	GATC	4 cut(s)	61, 316, 345, 406
BspACI	CCGC	6 cut(s)	57, 68, 87, 102, 129, 142
BspCNI	CTCAG	1 cut(s)	95
BspLI	GGNNCC	2 cut(s)	140, 195
BspPI	GGATC	2 cut(s)	311, 353
BspT107I	GGYRCC	1 cut(s)	138
BsrI	ACTGG	2 cut(s)	14, 374
BssECI	CCNNGG	2 cut(s)	76, 320
BssMI	GATC	4 cut(s)	61, 316, 345, 406
Bst2UI	CCWGG	1 cut(s)	321
BstC8I	GCNNGC	2 cut(s)	73, 95
BstDEI	CTNAG	1 cut(s)	82
BstEII	GGTNACC	1 cut(s)	324
BstKTI	GATC	4 cut(s)	64, 319, 348, 409
BstMBI	GATC	4 cut(s)	61, 316, 345, 406
BstMWI	GCNNNNNNNGC	2 cut(s)	41, 99
BstNI	CCWGG	1 cut(s)	321
BstPI	GGTNACC	1 cut(s)	324
BstSCI	CCNGG	1 cut(s)	319
BstV1I	GCAGC	2 cut(s)	22, 248
BstV2I	GAAGAC	1 cut(s)	250
Cac8I	GCNNGC	2 cut(s)	73, 95
Csp6I	GTAC	1 cut(s)	139
CviAII	CATG	4 cut(s)	45, 155, 223, 438
CviJI	RGCY	5 cut(s)	75, 81, 93, 215, 278
CviKI_1	RGCY	5 cut(s)	75, 81, 93, 215, 278
CviQI	GTAC	1 cut(s)	139
DdeI	CTNAG	1 cut(s)	82
DpnI	GATC	4 cut(s)	63, 318, 347, 408
DpnII	GATC	4 cut(s)	61, 316, 345, 406
Eco91I	GGTNACC	1 cut(s)	324
EcoO65I	GGTNACC	1 cut(s)	324
EcoRII	CCWGG	1 cut(s)	319
EcoT22I	ATGCAT	1 cut(s)	6
FaeI	CATG	4 cut(s)	48, 158, 226, 441
FatI	CATG	4 cut(s)	44, 154, 222, 437
FauNDI	CATATG	1 cut(s)	252
FblI	GTMKAC	1 cut(s)	151
Fnu4HI	GCNGC	3 cut(s)	36, 69, 237
Fsp4HI	GCNGC	3 cut(s)	36, 69, 237
FspBI	CTAG	1 cut(s)	183
GluI	GCNGC	3 cut(s)	36, 69, 237
Hin1II	CATG	4 cut(s)	48, 158, 226, 441
HincII	GTYRAC	1 cut(s)	152
HindII	GTYRAC	1 cut(s)	152
HinfI	GANTC	2 cut(s)	171, 179
HphI	GGTGA	2 cut(s)	71, 116
Hpy166II	GTNNAC	1 cut(s)	152
Hpy188III	TCNNGA	3 cut(s)	314, 349, 410
Hpy8I	GTNNAC	1 cut(s)	152
HpyCH4V	TGCA	3 cut(s)	4, 236, 425
HpyF10VI	GCNNNNNNNGC	2 cut(s)	41, 99
HpyF3I	CTNAG	1 cut(s)	82
Hsp92II	CATG	4 cut(s)	48, 158, 226, 441
KpnI	GGTACC	1 cut(s)	142
Kzo9I	GATC	4 cut(s)	61, 316, 345, 406
Lsp1109I	GCAGC	2 cut(s)	22, 248
LweI	GCATC	1 cut(s)	13
MaeI	CTAG	1 cut(s)	183
MaeIII	GTNAC	1 cut(s)	324
MalI	GATC	4 cut(s)	63, 318, 347, 408
MboI	GATC	4 cut(s)	61, 316, 345, 406
MboII	GAAGA	1 cut(s)	255
MluCI	AATT	4 cut(s)	262, 283, 358, 378
MnlI	CCTC	2 cut(s)	17, 71
Mph1103I	ATGCAT	1 cut(s)	6
MseI	TTAA	1 cut(s)	282
MspA1I	CMGCKG	2 cut(s)	57, 144
MspR9I	CCNGG	1 cut(s)	321
MvaI	CCWGG	1 cut(s)	321
MwoI	GCNNNNNNNGC	2 cut(s)	41, 99
NdeI	CATATG	1 cut(s)	252
NdeII	GATC	4 cut(s)	61, 316, 345, 406
NlaIII	CATG	4 cut(s)	48, 158, 226, 441
NlaIV	GGNNCC	2 cut(s)	140, 195
NmeAIII	GCCGAG	1 cut(s)	101
NsiI	ATGCAT	1 cut(s)	6
PcsI	WCGNNNNNNNCGW	1 cut(s)	157
PfeI	GAWTC	2 cut(s)	171, 179
PflMI	CCANNNNNTGG	1 cut(s)	20
PkrI	GCNGC	3 cut(s)	37, 70, 238
Psp6I	CCWGG	1 cut(s)	319
PspEI	GGTNACC	1 cut(s)	324
PspGI	CCWGG	1 cut(s)	319
PspN4I	GGNNCC	2 cut(s)	140, 195
RsaI	GTAC	1 cut(s)	140
RsaNI	GTAC	1 cut(s)	139
SalI	GTCGAC	1 cut(s)	150
SaqAI	TTAA	1 cut(s)	282
SatI	GCNGC	3 cut(s)	36, 69, 237
Sau3AI	GATC	4 cut(s)	61, 316, 345, 406
ScrFI	CCNGG	1 cut(s)	321
SetI	ASST	3 cut(s)	28, 118, 366
SfaNI	GCATC	1 cut(s)	13
Sse9I	AATT	4 cut(s)	262, 283, 358, 378
SsiI	CCGC	6 cut(s)	57, 68, 87, 102, 129, 142
SspMI	CTAG	1 cut(s)	183
StyD4I	CCNGG	1 cut(s)	319
TaqI	TCGA	2 cut(s)	151, 405
TasI	AATT	4 cut(s)	262, 283, 358, 378
TauI	GCSGC	1 cut(s)	71
TfiI	GAWTC	2 cut(s)	171, 179
Tru1I	TTAA	1 cut(s)	282
Tru9I	TTAA	1 cut(s)	282
TseI	GCWGC	2 cut(s)	35, 236
Van91I	CCANNNNNTGG	1 cut(s)	20
XapI	RAATTY	1 cut(s)	262
XmiI	GTMKAC	1 cut(s)	151
XspI	CTAG	1 cut(s)	183
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.