Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005802.1

Orthogroup ID

OG0025530

Physical Location & Seq

Genomic Coordinates Reverse (-)

116262 .. 120870

Gene Structure 4609 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1218 bp

atgaaagttgcagtgattggttctggtattagtggtttggtctcagcctatgttcttgcaaaagaaggtgttgaggtggttctatatgagaaaaaagactacctgggtggccatgccaggactgtcacatatgatggtgttgatttggaccttggtttcatggtctttaatcatgtactgtatccaaatatgatggagttttttgagagccttggagttgatatggagacatgcgacatgtccttctcagtgagtttagataaaggacggggatgtgaatggggtagtcgaaatagtctctcaagcttgtttgcagaaaagaagaacttgttcaatccatacttctggaaaatgcttcgagaaatcaccaagtttaaacatgacttgatcagatattctgaggtgcttgagggtaacccagacattgaccggaatgaaaccttggggcagtttattgaatcacatgactactctgaactatttctgaaggcttaccttattccaatatgtagttcaatcttgtcgtgtccttcagaaggggttatgagcttctcagctttctctgtgctttcagtttgtcgcaatcatcatctgcttcagctatttggaggcccacagtggcttaccgtcaaatggggttcacattgttatgtcaagaaggtgaaagaagtgttggagagtaaagggtgtcagataagaaccggctctgaggtgcataaagtttccacaactgatgaggctatccatgcccctgatgccgtgagaatattaggagaacaggcaacatctgatgaactgagaatacttggcgccttccaatatgtgtaccggtatacctttaacctcagtgaaacaagtcaaccatatcttgtgacactcaatccagatcatacaccaaaccacaccttgcttaagtggtcaacaagccatccagtcctatctgttgcagcatcaaaagcttcgctggagtttcctcatattcaaggaaagagaggaatttggttttgtggagcataccagggttacggcttccatgaggatgggctaaaggctagaattgatgagaaccatgaggttctagatattggttttggttggggaacctttgctattgaagcagtcaaacaaacgggctgcagatacactggcatcactctatccgaggaacaacttaaatttgctgaaaagaaagtgaaagatgctggacttcaggtataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006629 GO:0008150 GO:0008152 GO:0008168 GO:0008757 GO:0008825 GO:0009987 GO:0016740 GO:0016741 GO:0030258 GO:0032259 GO:0044237 GO:0044238 GO:0044255 GO:0044424 GO:0044444 GO:0044464 GO:0071704

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Amino_oxidase CMAS NAD_binding_8

Protein Analysis

405

Amino Acids

45.48

Weight (kDa)

5.93

Isoelectric Point (pI)

26.88

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DAO	PF01266	2 - 39	1.6e-07	FAD dependent oxidoreductase
FAD_binding_2	PF00890	3 - 39	7e-06	FAD binding domain
FAD_oxidored	PF12831	3 - 70	7.4e-06	FAD dependent oxidoreductase
NAD_binding_8	PF13450	5 - 71	1.3e-17	NAD(P)-binding Rossmann-like domain
Amino_oxidase	PF01593	10 - 246	1.6e-16	Flavin containing amine oxidoreductase
CMAS	PF02353	350 - 404	3.7e-10	Mycolic acid cyclopropane synthetase
Methyltransf_25	PF13649	359 - 404	1.3e-06	Methyltransferase domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025530)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_co8390575.1_g000001 Rmu_sc0002294.1_g000007 Rmu_sc0005802.1_g000025

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	809
AccI	GTMKAC	1 cut(s)	833
AcoI	YGGCCR	1 cut(s)	109
AcsI	RAATTY	2 cut(s)	996, 1175
AcuI	CTGAAG	4 cut(s)	506, 516, 581, 1193
AcyI	GRCGYC	1 cut(s)	810
AfaI	GTAC	2 cut(s)	177, 827
AfiI	CCNNNNNNNGG	2 cut(s)	536, 633
AflII	CTTAAG	1 cut(s)	911
AflIII	ACRYGT	1 cut(s)	237
AgeI	ACCGGT	1 cut(s)	828
AgsI	TTSAA	5 cut(s)	334, 458, 516, 983, 1115
AjnI	CCWGG	3 cut(s)	102, 116, 1017
AjuI	GAANNNNNNNTTGG	6 cut(s)	425, 457, 496, 528, 656, 688
AluBI	AGCT	5 cut(s)	306, 549, 557, 601, 959
AluI	AGCT	5 cut(s)	306, 549, 557, 601, 959
Alw26I	GTCTC	3 cut(s)	46, 221, 302
AoxI	GGCC	2 cut(s)	109, 610
ApeKI	GCWGC	2 cut(s)	947, 1134
ApoI	RAATTY	2 cut(s)	996, 1175
AsiGI	ACCGGT	1 cut(s)	828
Asp700I	GAANNNNTTC	2 cut(s)	329, 480
AspLEI	GCGC	1 cut(s)	812
AspS9I	GGNCC	2 cut(s)	148, 611
AsuHPI	GGTGA	2 cut(s)	358, 673
AvaII	GGWCC	1 cut(s)	148
BalI	TGGCCA	1 cut(s)	111
BanI	GGYRCC	1 cut(s)	809
BbvI	GCAGC	2 cut(s)	959, 1121
BccI	CCATC	4 cut(s)	128, 187, 936, 1034
BceAI	ACGGC	2 cut(s)	743, 1042
BciT130I	CCWGG	3 cut(s)	104, 118, 1019
BciVI	GTATCC	1 cut(s)	192
BclI	TGATCA	1 cut(s)	387
BcoDI	GTCTC	3 cut(s)	46, 221, 302
BfaI	CTAG	2 cut(s)	1053, 1079
BfmI	CTRYAG	1 cut(s)	1135
BfoI	RGCGCY	1 cut(s)	813
BfrI	CTTAAG	1 cut(s)	911
BfuI	GTATCC	1 cut(s)	192
BisI	GCNGC	2 cut(s)	948, 1135
BlsI	GCNGC	2 cut(s)	949, 1136
Bme1390I	CCNGG	3 cut(s)	104, 118, 1019
Bme18I	GGWCC	1 cut(s)	148
BmgT120I	GGNCC	2 cut(s)	148, 611
BmiI	GGNNCC	2 cut(s)	811, 1102
BmrFI	CCNGG	3 cut(s)	104, 118, 1019
BmsI	GCATC	4 cut(s)	745, 959, 1158, 1189
BpmI	CTGGAG	1 cut(s)	986
BpuEI	CTTGAG	2 cut(s)	286, 428
BsaHI	GRCGYC	1 cut(s)	810
BsaI	GGTCTC	1 cut(s)	46
BsaJI	CCNNGG	6 cut(s)	103, 151, 211, 441, 1018, 1161
BsaWI	WCCGGW	2 cut(s)	429, 828
Bsc4I	CCNNNNNNNGG	2 cut(s)	536, 633
Bse118I	RCCGGY	2 cut(s)	701, 828
Bse1I	ACTGG	2 cut(s)	932, 1150
BseBI	CCWGG	3 cut(s)	104, 118, 1019
BseDI	CCNNGG	6 cut(s)	103, 151, 211, 441, 1018, 1161
BseGI	GGATG	3 cut(s)	278, 928, 1045
BseLI	CCNNNNNNNGG	2 cut(s)	536, 633
BseMII	CTCAG	7 cut(s)	57, 261, 390, 567, 699, 788, 859
BseNI	ACTGG	2 cut(s)	932, 1150
BseXI	GCAGC	2 cut(s)	959, 1121
BshFI	GGCC	2 cut(s)	111, 612
BshNI	GGYRCC	1 cut(s)	809
BshTI	ACCGGT	1 cut(s)	828
BsiSI	CCGG	3 cut(s)	430, 702, 829
BslI	CCNNNNNNNGG	2 cut(s)	536, 633
BsmAI	GTCTC	3 cut(s)	46, 221, 302
BsnI	GGCC	2 cut(s)	111, 612
Bso31I	GGTCTC	1 cut(s)	46
Bsp143I	GATC	2 cut(s)	387, 886
BspANI	GGCC	2 cut(s)	111, 612
BspCNI	CTCAG	7 cut(s)	56, 260, 391, 566, 700, 789, 858
BspLI	GGNNCC	2 cut(s)	811, 1102
BspMAI	CTGCAG	1 cut(s)	1139
BspT107I	GGYRCC	1 cut(s)	809
BspTI	CTTAAG	1 cut(s)	911
BspTNI	GGTCTC	1 cut(s)	46
BsrFI	RCCGGY	2 cut(s)	701, 828
BsrI	ACTGG	2 cut(s)	932, 1150
BssAI	RCCGGY	2 cut(s)	701, 828
BssECI	CCNNGG	6 cut(s)	103, 151, 211, 441, 1018, 1161
BssMI	GATC	2 cut(s)	387, 886
BssNAI	GTATAC	1 cut(s)	834
BssNI	GRCGYC	1 cut(s)	810
BssT1I	CCWWGG	3 cut(s)	151, 211, 441
Bst1107I	GTATAC	1 cut(s)	834
Bst2UI	CCWGG	3 cut(s)	104, 118, 1019
Bst4CI	ACNGT	4 cut(s)	124, 180, 618, 628
BstACI	GRCGYC	1 cut(s)	810
BstAFI	CTTAAG	1 cut(s)	911
BstDEI	CTNAG	7 cut(s)	43, 247, 399, 553, 708, 797, 845
BstEII	GGTNACC	1 cut(s)	413
BstENI	CCTNNNNNAGG	1 cut(s)	534
BstF5I	GGATG	3 cut(s)	278, 928, 1045
BstH2I	RGCGCY	1 cut(s)	813
BstHHI	GCGC	1 cut(s)	812
BstKTI	GATC	2 cut(s)	390, 889
BstMAI	GTCTC	3 cut(s)	46, 221, 302
BstMBI	GATC	2 cut(s)	387, 886
BstMWI	GCNNNNNNNGC	4 cut(s)	746, 755, 956, 1115
BstNI	CCWGG	3 cut(s)	104, 118, 1019
BstNSI	RCATGY	2 cut(s)	234, 241
BstPI	GGTNACC	1 cut(s)	413
BstSCI	CCNGG	3 cut(s)	102, 116, 1017
BstSFI	CTRYAG	1 cut(s)	1135
BstV1I	GCAGC	2 cut(s)	959, 1121
BstXI	CCANNNNNNTGG	2 cut(s)	345, 1040
BstZ17I	GTATAC	1 cut(s)	834
BsuI	GTATCC	1 cut(s)	192
BsuRI	GGCC	2 cut(s)	111, 612
BtsCI	GGATG	3 cut(s)	278, 928, 1045
BtsI	GCAGTG	1 cut(s)	18
BtsIMutI	CAGTG	5 cut(s)	18, 255, 623, 853, 1143
CfoI	GCGC	1 cut(s)	812
Cfr10I	RCCGGY	2 cut(s)	701, 828
Cfr13I	GGNCC	2 cut(s)	148, 611
Csp6I	GTAC	2 cut(s)	176, 826
CspAI	ACCGGT	1 cut(s)	828
CviQI	GTAC	2 cut(s)	176, 826
DdeI	CTNAG	7 cut(s)	43, 247, 399, 553, 708, 797, 845
DinI	GGCGCC	1 cut(s)	811
DpnI	GATC	2 cut(s)	389, 888
DpnII	GATC	2 cut(s)	387, 886
DraI	TTTAAA	1 cut(s)	376
EaeI	YGGCCR	1 cut(s)	109
Eco130I	CCWWGG	3 cut(s)	151, 211, 441
Eco31I	GGTCTC	1 cut(s)	46
Eco47I	GGWCC	1 cut(s)	148
Eco57I	CTGAAG	4 cut(s)	506, 516, 581, 1193
Eco91I	GGTNACC	1 cut(s)	413
EcoNI	CCTNNNNNAGG	1 cut(s)	534
EcoO65I	GGTNACC	1 cut(s)	413
EcoRII	CCWGG	3 cut(s)	102, 116, 1017
EcoT14I	CCWWGG	3 cut(s)	151, 211, 441
EgeI	GGCGCC	1 cut(s)	811
EheI	GGCGCC	1 cut(s)	811
ErhI	CCWWGG	3 cut(s)	151, 211, 441
FalI	AAGNNNNNCTT	2 cut(s)	311, 343
FauNDI	CATATG	1 cut(s)	130
FbaI	TGATCA	1 cut(s)	387
FblI	GTMKAC	1 cut(s)	833
Fnu4HI	GCNGC	2 cut(s)	948, 1135
FokI	GGATG	3 cut(s)	285, 915, 1052
Fsp4HI	GCNGC	2 cut(s)	948, 1135
FspBI	CTAG	2 cut(s)	1053, 1079
GlaI	GCGC	1 cut(s)	811
GluI	GCNGC	2 cut(s)	948, 1135
GsuI	CTGGAG	1 cut(s)	986
HaeII	RGCGCY	1 cut(s)	813
HaeIII	GGCC	2 cut(s)	111, 612
HapII	CCGG	3 cut(s)	430, 702, 829
HhaI	GCGC	1 cut(s)	812
Hin1I	GRCGYC	1 cut(s)	810
Hin6I	GCGC	1 cut(s)	810
HinP1I	GCGC	1 cut(s)	810
HincII	GTYRAC	2 cut(s)	860, 921
HindII	GTYRAC	2 cut(s)	860, 921
HindIII	AAGCTT	2 cut(s)	304, 957
HinfI	GANTC	1 cut(s)	458
HpaII	CCGG	3 cut(s)	430, 702, 829
HphI	GGTGA	2 cut(s)	358, 673
Hpy166II	GTNNAC	5 cut(s)	641, 826, 834, 860, 921
Hpy188I	TCNGA	9 cut(s)	392, 400, 475, 486, 535, 693, 709, 790, 1162
Hpy188III	TCNNGA	5 cut(s)	346, 359, 655, 884, 1079
Hpy8I	GTNNAC	5 cut(s)	641, 826, 834, 860, 921
HpyAV	CCTTC	7 cut(s)	59, 253, 481, 530, 540, 652, 823
HpyCH4III	ACNGT	4 cut(s)	124, 180, 618, 628
HpyCH4V	TGCA	6 cut(s)	11, 59, 314, 715, 947, 1137
HpyF10VI	GCNNNNNNNGC	4 cut(s)	746, 755, 956, 1115
HpyF3I	CTNAG	7 cut(s)	43, 247, 399, 553, 708, 797, 845
Hsp92I	GRCGYC	1 cut(s)	810
HspAI	GCGC	1 cut(s)	810
KasI	GGCGCC	1 cut(s)	809
Ksp22I	TGATCA	1 cut(s)	387
Kzo9I	GATC	2 cut(s)	387, 886
LmnI	GCTCC	1 cut(s)	1010
Lsp1109I	GCAGC	2 cut(s)	959, 1121
LweI	GCATC	4 cut(s)	745, 959, 1158, 1189
MaeI	CTAG	2 cut(s)	1053, 1079
MaeIII	GTNAC	4 cut(s)	124, 413, 871, 1022
MalI	GATC	2 cut(s)	389, 888
MboI	GATC	2 cut(s)	387, 886
MboII	GAAGA	1 cut(s)	334
MlsI	TGGCCA	1 cut(s)	111
MluCI	AATT	3 cut(s)	996, 1056, 1175
MluNI	TGGCCA	1 cut(s)	111
Mly113I	GGCGCC	1 cut(s)	810
MmeI	TCCRAC	1 cut(s)	654
Mox20I	TGGCCA	1 cut(s)	111
MroXI	GAANNNNTTC	2 cut(s)	329, 480
MscI	TGGCCA	1 cut(s)	111
MseI	TTAA	5 cut(s)	168, 375, 840, 912, 1173
MslI	CAYNNNNRTG	2 cut(s)	648, 1038
Msp20I	TGGCCA	1 cut(s)	111
MspCI	CTTAAG	1 cut(s)	911
MspI	CCGG	3 cut(s)	430, 702, 829
MspR9I	CCNGG	3 cut(s)	104, 118, 1019
MssI	GTTTAAAC	1 cut(s)	376
MvaI	CCWGG	3 cut(s)	104, 118, 1019
MwoI	GCNNNNNNNGC	4 cut(s)	746, 755, 956, 1115
NarI	GGCGCC	1 cut(s)	810
NdeI	CATATG	1 cut(s)	130
NdeII	GATC	2 cut(s)	387, 886
NlaIV	GGNNCC	2 cut(s)	811, 1102
NmuCI	GTSAC	2 cut(s)	124, 871
NspI	RCATGY	2 cut(s)	234, 241
PciI	ACATGT	1 cut(s)	237
PdmI	GAANNNNTTC	2 cut(s)	329, 480
PfeI	GAWTC	1 cut(s)	458
PinAI	ACCGGT	1 cut(s)	828
PkrI	GCNGC	2 cut(s)	949, 1136
PluTI	GGCGCC	1 cut(s)	813
PmeI	GTTTAAAC	1 cut(s)	376
PscI	ACATGT	1 cut(s)	237
Psp6I	CCWGG	3 cut(s)	102, 116, 1017
PspEI	GGTNACC	1 cut(s)	413
PspGI	CCWGG	3 cut(s)	102, 116, 1017
PspN4I	GGNNCC	2 cut(s)	811, 1102
PspPI	GGNCC	2 cut(s)	148, 611
PsrI	GAACNNNNNNTAC	2 cut(s)	786, 818
PstI	CTGCAG	1 cut(s)	1139
RsaI	GTAC	2 cut(s)	177, 827
RsaNI	GTAC	2 cut(s)	176, 826
RseI	CAYNNNNRTG	2 cut(s)	648, 1038
SaqAI	TTAA	5 cut(s)	168, 375, 840, 912, 1173
SatI	GCNGC	2 cut(s)	948, 1135
Sau3AI	GATC	2 cut(s)	387, 886
Sau96I	GGNCC	2 cut(s)	148, 611
ScrFI	CCNGG	3 cut(s)	104, 118, 1019
SfaNI	GCATC	4 cut(s)	745, 959, 1158, 1189
SfcI	CTRYAG	1 cut(s)	1135
SfoI	GGCGCC	1 cut(s)	811
SinI	GGWCC	1 cut(s)	148
SmiMI	CAYNNNNRTG	2 cut(s)	648, 1038
SmlI	CTYRAG	3 cut(s)	301, 407, 911
SmoI	CTYRAG	3 cut(s)	301, 407, 911
Sse9I	AATT	3 cut(s)	996, 1056, 1175
SspDI	GGCGCC	1 cut(s)	809
SspI	AATATT	1 cut(s)	768
SspMI	CTAG	2 cut(s)	1053, 1079
StyD4I	CCNGG	3 cut(s)	102, 116, 1017
StyI	CCWWGG	3 cut(s)	151, 211, 441
TaaI	ACNGT	4 cut(s)	124, 180, 618, 628
TaqI	TCGA	2 cut(s)	289, 358
TasI	AATT	3 cut(s)	996, 1056, 1175
TatI	WGTACW	1 cut(s)	175
TfiI	GAWTC	1 cut(s)	458
Tru1I	TTAA	5 cut(s)	168, 375, 840, 912, 1173
Tru9I	TTAA	5 cut(s)	168, 375, 840, 912, 1173
TscAI	CASTG	5 cut(s)	18, 255, 623, 853, 1150
TseFI	GTSAC	2 cut(s)	124, 871
TseI	GCWGC	2 cut(s)	947, 1134
Tsp45I	GTSAC	2 cut(s)	124, 871
TspDTI	ATGAA	4 cut(s)	17, 148, 450, 807
TspRI	CASTG	5 cut(s)	18, 255, 623, 853, 1150
Vha464I	CTTAAG	1 cut(s)	911
VpaK11BI	GGWCC	1 cut(s)	148
XagI	CCTNNNNNAGG	1 cut(s)	534
XapI	RAATTY	2 cut(s)	996, 1175
XbaI	TCTAGA	1 cut(s)	1078
XceI	RCATGY	2 cut(s)	234, 241
XmiI	GTMKAC	1 cut(s)	833
XmnI	GAANNNNTTC	2 cut(s)	329, 480
XspI	CTAG	2 cut(s)	1053, 1079

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.