Rmu_sc0006023.1_g000001

Belongs to the cullin family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006023.1
Physical Location & Seq
Forward (+)
1 .. 371
371 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006023.1_g000001.1.cds

Sequence Viewer

Length: 210 bp
gcgaagctcgacgagatgagtgctcagaagaagaggaacttccaaattgaggcgtttaagcatcgggtcgtggttgatccgaaatacgcagagaagacctggacgatcctggagcatgccatcagagaaatctataatcacaatgctagcgggctcagttttgaagagctttataggtttgctactctttgctttgcatgtagacaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

8.19

Weight (kDa)

8.69

Isoelectric Point (pI)

39.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029529)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0339221
rosa_multiflora Rmu_sc0006023.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 202
AciI CCGC 1 cut(s) 150
AclWI GGATC 2 cut(s) 71, 100
AfiI CCNNNNNNNGG 1 cut(s) 49
AgsI TTSAA 1 cut(s) 164
AjnI CCWGG 2 cut(s) 98, 108
AluBI AGCT 2 cut(s) 7, 169
AluI AGCT 2 cut(s) 7, 169
Alw21I GWGCWC 1 cut(s) 25
AlwI GGATC 2 cut(s) 71, 100
AsuNHI GCTAGC 1 cut(s) 146
BanII GRGCYC 1 cut(s) 156
BbsI GAAGAC 1 cut(s) 101
Bbv12I GWGCWC 1 cut(s) 25
BccI CCATC 1 cut(s) 128
BcgI CGANNNNNNTGC 1 cut(s) 36
BciT130I CCWGG 2 cut(s) 100, 110
BfaI CTAG 1 cut(s) 147
Bme1390I CCNGG 2 cut(s) 100, 110
BmrFI CCNGG 2 cut(s) 100, 110
BmsI GCATC 1 cut(s) 70
BmtI GCTAGC 1 cut(s) 150
BpiI GAAGAC 1 cut(s) 101
BpmI CTGGAG 1 cut(s) 131
Bsc4I CCNNNNNNNGG 1 cut(s) 49
BseBI CCWGG 2 cut(s) 100, 110
BseLI CCNNNNNNNGG 1 cut(s) 49
BseMII CTCAG 2 cut(s) 38, 169
BsiHKAI GWGCWC 1 cut(s) 25
BslI CCNNNNNNNGG 1 cut(s) 49
Bsp1286I GDGCHC 2 cut(s) 25, 156
Bsp143I GATC 2 cut(s) 76, 105
BspACI CCGC 1 cut(s) 150
BspCNI CTCAG 2 cut(s) 37, 168
BspOI GCTAGC 1 cut(s) 150
BspPI GGATC 2 cut(s) 71, 100
BspQI GCTCTTC 1 cut(s) 159
BssMI GATC 2 cut(s) 76, 105
Bst2UI CCWGG 2 cut(s) 100, 110
Bst6I CTCTTC 2 cut(s) 26, 159
BstC8I GCNNGC 3 cut(s) 117, 148, 152
BstDEI CTNAG 2 cut(s) 24, 155
BstKTI GATC 2 cut(s) 79, 108
BstMBI GATC 2 cut(s) 76, 105
BstNI CCWGG 2 cut(s) 100, 110
BstNSI RCATGY 2 cut(s) 119, 201
BstSCI CCNGG 2 cut(s) 98, 108
BstV2I GAAGAC 1 cut(s) 101
Cac8I GCNNGC 3 cut(s) 117, 148, 152
CviAII CATG 2 cut(s) 116, 198
CviJI RGCY 3 cut(s) 7, 154, 169
CviKI_1 RGCY 3 cut(s) 7, 154, 169
DdeI CTNAG 2 cut(s) 24, 155
DpnI GATC 2 cut(s) 78, 107
DpnII GATC 2 cut(s) 76, 105
Eam1104I CTCTTC 2 cut(s) 26, 159
EarI CTCTTC 2 cut(s) 26, 159
Eco24I GRGCYC 1 cut(s) 156
EcoRII CCWGG 2 cut(s) 98, 108
EcoT38I GRGCYC 1 cut(s) 156
FaeI CATG 2 cut(s) 119, 201
FaiI YATR 4 cut(s) 117, 135, 174, 199
FalI AAGNNNNNCTT 2 cut(s) 23, 55
FatI CATG 2 cut(s) 115, 197
FauI CCCGC 1 cut(s) 143
FblI GTMKAC 1 cut(s) 202
FriOI GRGCYC 1 cut(s) 156
FspBI CTAG 1 cut(s) 147
GsuI CTGGAG 1 cut(s) 131
Hin1II CATG 2 cut(s) 119, 201
Hpy166II GTNNAC 1 cut(s) 203
Hpy188I TCNGA 3 cut(s) 27, 81, 125
Hpy8I GTNNAC 1 cut(s) 203
Hpy99I CGWCG 1 cut(s) 14
HpyCH4V TGCA 1 cut(s) 197
HpyF3I CTNAG 2 cut(s) 24, 155
Hsp92II CATG 2 cut(s) 119, 201
Kzo9I GATC 2 cut(s) 76, 105
LguI GCTCTTC 1 cut(s) 159
LmnI GCTCC 1 cut(s) 112
LpnPI CCDG 4 cut(s) 85, 95, 112, 122
LweI GCATC 1 cut(s) 70
MaeI CTAG 1 cut(s) 147
MalI GATC 2 cut(s) 78, 107
MboI GATC 2 cut(s) 76, 105
MboII GAAGA 4 cut(s) 40, 43, 106, 176
MhlI GDGCHC 2 cut(s) 25, 156
MluCI AATT 1 cut(s) 45
MnlI CCTC 2 cut(s) 27, 43
MseI TTAA 1 cut(s) 57
MspR9I CCNGG 2 cut(s) 100, 110
MvaI CCWGG 2 cut(s) 100, 110
NdeII GATC 2 cut(s) 76, 105
NheI GCTAGC 1 cut(s) 146
NlaIII CATG 2 cut(s) 119, 201
NspI RCATGY 2 cut(s) 119, 201
PaeI GCATGC 1 cut(s) 119
PciSI GCTCTTC 1 cut(s) 159
PfoI TCCNGGA 1 cut(s) 108
Psp6I CCWGG 2 cut(s) 98, 108
PspGI CCWGG 2 cut(s) 98, 108
SapI GCTCTTC 1 cut(s) 159
SaqAI TTAA 1 cut(s) 57
Sau3AI GATC 2 cut(s) 76, 105
ScrFI CCNGG 2 cut(s) 100, 110
SduI GDGCHC 2 cut(s) 25, 156
SetI ASST 4 cut(s) 9, 101, 171, 179
SfaNI GCATC 1 cut(s) 70
SphI GCATGC 1 cut(s) 119
Sse9I AATT 1 cut(s) 45
SsiI CCGC 1 cut(s) 150
SspMI CTAG 1 cut(s) 147
StyD4I CCNGG 2 cut(s) 98, 108
TaqI TCGA 1 cut(s) 9
TasI AATT 1 cut(s) 45
Tru1I TTAA 1 cut(s) 57
Tru9I TTAA 1 cut(s) 57
XceI RCATGY 2 cut(s) 119, 201
XmiI GTMKAC 1 cut(s) 202
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.