Rmu_sc0006442.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006442.1
OG0030052
Physical Location & Seq
Forward (+)
1 .. 1130
1130 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006442.1_g000001.1.cds

Sequence Viewer

Length: 258 bp
gatgcagcttccctatctgttgcaatcttaaagaatcaattacgtaaccggattctcttgggttgtgacaatcatccattgtccaggaaagaagtgatggacttggttaataaaagtgggaaatttaccaaagtgtttgagagctttacaggaactactgatccattgggaaagcgattaaacaactcaaaaactcgcgcagaaatagggtgggaaccaaaataccccagtttctctcaattccttgagagtctctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.56

Weight (kDa)

9.52

Isoelectric Point (pI)

37.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030052)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0421081
rosa_multiflora Rmu_sc0006442.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 198
AclWI GGATC 1 cut(s) 155
AcsI RAATTY 1 cut(s) 122
AjnI CCWGG 1 cut(s) 83
AloI GAACNNNNNNTCC 2 cut(s) 145, 177
AluBI AGCT 2 cut(s) 8, 144
AluI AGCT 2 cut(s) 8, 144
AlwI GGATC 1 cut(s) 155
ApeKI GCWGC 1 cut(s) 5
ApoI RAATTY 1 cut(s) 122
AspLEI GCGC 1 cut(s) 200
BbvI GCAGC 1 cut(s) 17
BccI CCATC 1 cut(s) 91
BciT130I CCWGG 1 cut(s) 85
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
Bme1390I CCNGG 1 cut(s) 85
BmiI GGNNCC 1 cut(s) 216
BmrFI CCNGG 1 cut(s) 85
BmrI ACTGGG 1 cut(s) 222
BmuI ACTGGG 1 cut(s) 222
BsaAI YACGTR 1 cut(s) 44
BsaWI WCCGGW 1 cut(s) 48
Bse1I ACTGG 1 cut(s) 228
BseBI CCWGG 1 cut(s) 85
BseGI GGATG 1 cut(s) 73
BseNI ACTGG 1 cut(s) 228
BseXI GCAGC 1 cut(s) 17
Bsh1236I CGCG 1 cut(s) 198
BsiSI CCGG 1 cut(s) 49
Bsp143I GATC 1 cut(s) 160
BspFNI CGCG 1 cut(s) 198
BspLI GGNNCC 1 cut(s) 216
BspPI GGATC 1 cut(s) 155
BsrI ACTGG 1 cut(s) 228
BssMI GATC 1 cut(s) 160
Bst2UI CCWGG 1 cut(s) 85
BstBAI YACGTR 1 cut(s) 44
BstF5I GGATG 1 cut(s) 73
BstFNI CGCG 1 cut(s) 198
BstHHI GCGC 1 cut(s) 200
BstKTI GATC 1 cut(s) 163
BstMBI GATC 1 cut(s) 160
BstNI CCWGG 1 cut(s) 85
BstSCI CCNGG 1 cut(s) 83
BstSNI TACGTA 1 cut(s) 44
BstUI CGCG 1 cut(s) 198
BstV1I GCAGC 1 cut(s) 17
BtsCI GGATG 1 cut(s) 73
CfoI GCGC 1 cut(s) 200
CviJI RGCY 2 cut(s) 8, 144
CviKI_1 RGCY 2 cut(s) 8, 144
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
Eco105I TACGTA 1 cut(s) 44
EcoRII CCWGG 1 cut(s) 83
Fnu4HI GCNGC 1 cut(s) 6
FokI GGATG 1 cut(s) 60
Fsp4HI GCNGC 1 cut(s) 6
GlaI GCGC 1 cut(s) 199
GluI GCNGC 1 cut(s) 6
HapII CCGG 1 cut(s) 49
HhaI GCGC 1 cut(s) 200
Hin6I GCGC 1 cut(s) 198
HinP1I GCGC 1 cut(s) 198
HinfI GANTC 3 cut(s) 34, 52, 250
HpaII CCGG 1 cut(s) 49
Hpy188I TCNGA 1 cut(s) 257
HpyCH4IV ACGT 1 cut(s) 43
HpyCH4V TGCA 2 cut(s) 5, 23
HpySE526I ACGT 1 cut(s) 43
HspAI GCGC 1 cut(s) 198
Kzo9I GATC 1 cut(s) 160
LpnPI CCDG 5 cut(s) 62, 70, 97, 135, 241
Lsp1109I GCAGC 1 cut(s) 17
MaeII ACGT 1 cut(s) 43
MaeIII GTNAC 2 cut(s) 44, 65
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MluCI AATT 3 cut(s) 38, 122, 239
MseI TTAA 3 cut(s) 29, 108, 179
MspI CCGG 1 cut(s) 49
MspR9I CCNGG 1 cut(s) 85
MvaI CCWGG 1 cut(s) 85
MvnI CGCG 1 cut(s) 198
NdeII GATC 1 cut(s) 160
NlaIV GGNNCC 1 cut(s) 216
NmuCI GTSAC 1 cut(s) 65
PfeI GAWTC 2 cut(s) 34, 52
PfoI TCCNGGA 1 cut(s) 83
PkrI GCNGC 1 cut(s) 7
Ppu21I YACGTR 1 cut(s) 44
Psp6I CCWGG 1 cut(s) 83
PspGI CCWGG 1 cut(s) 83
PspN4I GGNNCC 1 cut(s) 216
SaqAI TTAA 3 cut(s) 29, 108, 179
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 1 cut(s) 160
ScrFI CCNGG 1 cut(s) 85
SetI ASST 3 cut(s) 10, 46, 146
SgeI CNNG 9 cut(s) 61, 70, 96, 97, 115, 162, 207, 209, 240
SmlI CTYRAG 1 cut(s) 245
SmoI CTYRAG 1 cut(s) 245
SnaBI TACGTA 1 cut(s) 44
Sse9I AATT 3 cut(s) 38, 122, 239
StyD4I CCNGG 1 cut(s) 83
TaiI ACGT 1 cut(s) 46
TasI AATT 3 cut(s) 38, 122, 239
TfiI GAWTC 2 cut(s) 34, 52
Tru1I TTAA 3 cut(s) 29, 108, 179
Tru9I TTAA 3 cut(s) 29, 108, 179
TseFI GTSAC 1 cut(s) 65
TseI GCWGC 1 cut(s) 5
Tsp45I GTSAC 1 cut(s) 65
XapI RAATTY 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.