Rmu_sc0006737.1_g000015

Ankyrin repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006737.1
OG0031103
Physical Location & Seq
Forward (+)
49132 .. 50802
1671 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006737.1_g000015.1.cds

Sequence Viewer

Length: 855 bp
ctgggcgaaacccggccaggggagttctcccttaacaccctacgactgtcgaagtctccgctgagccaatccccgttaagcgaaatttccactcatcaaattgcaacaggcagcctctgctacactcaacactaccggcagagctccatccatcttgcaaacccgtgctttgctgagcgcaactccgctcaacagctaccacaaaacacgtctacgcgacgttgtttcctgctacaactagcagggggtatccgccaacaacgaatcccgaggctacacctcactctgacaacgaccgccacgcggcgttgcggtcagatcgtccctacgggacacgaggacttgtcaacagtctacgacgaccctgatcagccaagcgggctaccgcccgagcccgggatcgcccccggatcacaactaacgcgccgccacgcgccgcaccaagttagcatcagaagctctagacgctgggagtcgaagcacatcagtcccacatcgaaaacaaggagaatatcaaccttcccctcacctataaaagaacttgatcatttgtcctttataaaatcatacactggagagctataccttaatacatttgtgccgcttaataagtatgcactaaaaggcaattgggaagctgctgaacgaatcttgaaggtggatcagaggcttttgacttttagcataacaagaggatgggacactgtctttcacattgcagcgggagtaagacatgttcactttgtggagaagctggtcgaaataatggacgaacaagatttggcactgcaagacataaatcgaaacactgccttcagcattactgctatcgctggatatgagaccaaaaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank_2 PGG

Protein Analysis

284

Amino Acids

32.0

Weight (kDa)

9.56

Isoelectric Point (pI)

58.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031103)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000871.1_g000005 Rmu_sc0006737.1_g000015

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 560
AccBSI CCGCTC 1 cut(s) 188
AccI GTMKAC 2 cut(s) 212, 354
AccII CGCG 4 cut(s) 217, 304, 424, 434
AclWI GGATC 3 cut(s) 407, 418, 669
AcoI YGGCCR 1 cut(s) 14
AcsI RAATTY 1 cut(s) 84
AcuI CTGAAG 1 cut(s) 799
AdeI CACNNNGTG 1 cut(s) 745
AfiI CCNNNNNNNGG 5 cut(s) 18, 19, 303, 395, 396
AflIII ACRYGT 2 cut(s) 207, 733
AgsI TTSAA 1 cut(s) 655
AjiI CACGTC 1 cut(s) 210
AjnI CCWGG 1 cut(s) 16
AluBI AGCT 6 cut(s) 144, 196, 459, 580, 638, 754
AluI AGCT 6 cut(s) 144, 196, 459, 580, 638, 754
Alw21I GWGCWC 1 cut(s) 146
Alw26I GTCTC 2 cut(s) 60, 836
AlwI GGATC 3 cut(s) 407, 418, 669
AlwNI CAGNNNCTG 1 cut(s) 117
Ama87I CYCGRG 3 cut(s) 268, 389, 395
AoxI GGCC 1 cut(s) 14
ApeKI GCWGC 3 cut(s) 111, 638, 719
ApoI RAATTY 1 cut(s) 84
AspLEI GCGC 3 cut(s) 180, 426, 436
AsuC2I CCSGG 4 cut(s) 13, 396, 397, 408
AsuHPI GGTGA 1 cut(s) 519
AvaI CYCGRG 3 cut(s) 268, 389, 395
BanII GRGCYC 2 cut(s) 146, 396
BauI CACGAG 1 cut(s) 335
Bbv12I GWGCWC 1 cut(s) 146
BbvI GCAGC 3 cut(s) 123, 625, 731
BccI CCATC 3 cut(s) 155, 159, 690
BciT130I CCWGG 1 cut(s) 18
BciVI GTATCC 1 cut(s) 260
BclI TGATCA 2 cut(s) 367, 544
BcnI CCSGG 4 cut(s) 13, 396, 397, 408
BcoDI GTCTC 2 cut(s) 60, 836
BfaI CTAG 2 cut(s) 239, 462
BfuI GTATCC 1 cut(s) 260
BglI GCCNNNNNGGC 1 cut(s) 379
BisI GCNGC 7 cut(s) 112, 305, 427, 437, 602, 639, 720
BlpI GCTNAGC 2 cut(s) 62, 174
BlsI GCNGC 7 cut(s) 113, 306, 428, 438, 603, 640, 721
Bme1390I CCNGG 5 cut(s) 13, 18, 396, 397, 408
BmeT110I CYCGRG 3 cut(s) 268, 389, 395
BmgBI CACGTC 1 cut(s) 210
BmrFI CCNGG 5 cut(s) 13, 18, 396, 397, 408
BmsI GCATC 1 cut(s) 459
BplI GAGNNNNNCTC 2 cut(s) 167, 199
BpmI CTGGAG 1 cut(s) 594
Bpu1102I GCTNAGC 2 cut(s) 62, 174
BpuMI CCSGG 4 cut(s) 13, 396, 397, 408
BsaI GGTCTC 1 cut(s) 836
BsaJI CCNNGG 4 cut(s) 17, 269, 395, 406
Bsc4I CCNNNNNNNGG 5 cut(s) 18, 19, 303, 395, 396
Bse118I RCCGGY 1 cut(s) 135
Bse1I ACTGG 1 cut(s) 577
Bse3DI GCAATG 1 cut(s) 714
BseBI CCWGG 1 cut(s) 18
BseDI CCNNGG 4 cut(s) 17, 269, 395, 406
BseGI GGATG 2 cut(s) 147, 701
BseLI CCNNNNNNNGG 5 cut(s) 18, 19, 303, 395, 396
BseMI GCAATG 1 cut(s) 714
BseMII CTCAG 2 cut(s) 53, 165
BseNI ACTGG 1 cut(s) 577
BseXI GCAGC 3 cut(s) 123, 625, 731
BseYI CCCAGC 1 cut(s) 468
Bsh1236I CGCG 4 cut(s) 217, 304, 424, 434
Bsh1285I CGRYCG 1 cut(s) 297
BshFI GGCC 1 cut(s) 16
BsiEI CGRYCG 1 cut(s) 297
BsiHKAI GWGCWC 1 cut(s) 146
BsiHKCI CYCGRG 3 cut(s) 268, 389, 395
BsiSI CCGG 4 cut(s) 13, 136, 396, 408
BslFI GGGAC 4 cut(s) 308, 345, 474, 713
BslI CCNNNNNNNGG 5 cut(s) 18, 19, 303, 395, 396
BsmAI GTCTC 2 cut(s) 60, 836
BsmFI GGGAC 4 cut(s) 308, 345, 474, 713
BsnI GGCC 1 cut(s) 16
Bso31I GGTCTC 1 cut(s) 836
BsoBI CYCGRG 3 cut(s) 268, 389, 395
Bsp1286I GDGCHC 2 cut(s) 146, 396
Bsp143I GATC 6 cut(s) 318, 367, 399, 410, 544, 661
Bsp1720I GCTNAGC 2 cut(s) 62, 174
BspANI GGCC 1 cut(s) 16
BspCNI CTCAG 2 cut(s) 54, 166
BspFNI CGCG 4 cut(s) 217, 304, 424, 434
BspPI GGATC 3 cut(s) 407, 418, 669
BspTNI GGTCTC 1 cut(s) 836
BsrBI CCGCTC 1 cut(s) 188
BsrDI GCAATG 1 cut(s) 714
BsrFI RCCGGY 1 cut(s) 135
BsrI ACTGG 1 cut(s) 577
BssAI RCCGGY 1 cut(s) 135
BssECI CCNNGG 4 cut(s) 17, 269, 395, 406
BssMI GATC 6 cut(s) 318, 367, 399, 410, 544, 661
BssSI CACGAG 1 cut(s) 335
Bst2BI CACGAG 1 cut(s) 335
Bst2UI CCWGG 1 cut(s) 18
Bst4CI ACNGT 3 cut(s) 48, 352, 706
BstAPI GCANNNNNTGC 1 cut(s) 117
BstC8I GCNNGC 1 cut(s) 380
BstDEI CTNAG 2 cut(s) 62, 174
BstF5I GGATG 2 cut(s) 147, 701
BstFNI CGCG 4 cut(s) 217, 304, 424, 434
BstHHI GCGC 3 cut(s) 180, 426, 436
BstKTI GATC 6 cut(s) 321, 370, 402, 413, 547, 664
BstMAI GTCTC 2 cut(s) 60, 836
BstMBI GATC 6 cut(s) 318, 367, 399, 410, 544, 661
BstMCI CGRYCG 1 cut(s) 297
BstMWI GCNNNNNNNGC 4 cut(s) 117, 379, 456, 465
BstNI CCWGG 1 cut(s) 18
BstNSI RCATGY 1 cut(s) 737
BstSCI CCNGG 5 cut(s) 11, 16, 394, 395, 406
BstUI CGCG 4 cut(s) 217, 304, 424, 434
BstV1I GCAGC 3 cut(s) 123, 625, 731
BsuI GTATCC 1 cut(s) 260
BsuRI GGCC 1 cut(s) 16
BtrI CACGTC 1 cut(s) 210
BtsCI GGATG 2 cut(s) 147, 701
BtsI GCAGTG 2 cut(s) 785, 807
BtsIMutI CAGTG 4 cut(s) 570, 702, 785, 807
Cac8I GCNNGC 1 cut(s) 380
CaiI CAGNNNCTG 1 cut(s) 117
CfoI GCGC 3 cut(s) 180, 426, 436
Cfr10I RCCGGY 1 cut(s) 135
Cfr9I CCCGGG 1 cut(s) 395
CseI GACGC 1 cut(s) 474
CviAII CATG 1 cut(s) 734
DdeI CTNAG 2 cut(s) 62, 174
DpnI GATC 6 cut(s) 320, 369, 401, 412, 546, 663
DpnII GATC 6 cut(s) 318, 367, 399, 410, 544, 661
DraIII CACNNNGTG 1 cut(s) 745
EaeI YGGCCR 1 cut(s) 14
EciI GGCGGA 1 cut(s) 242
Ecl136II GAGCTC 1 cut(s) 144
Eco24I GRGCYC 2 cut(s) 146, 396
Eco31I GGTCTC 1 cut(s) 836
Eco53kI GAGCTC 1 cut(s) 144
Eco57I CTGAAG 1 cut(s) 799
Eco88I CYCGRG 3 cut(s) 268, 389, 395
EcoICRI GAGCTC 1 cut(s) 144
EcoRII CCWGG 1 cut(s) 16
EcoT38I GRGCYC 2 cut(s) 146, 396
FaeI CATG 1 cut(s) 737
FaiI YATR 9 cut(s) 533, 560, 568, 583, 615, 686, 735, 797, 840
FaqI GGGAC 4 cut(s) 308, 345, 474, 713
FatI CATG 1 cut(s) 733
FauI CCCGC 2 cut(s) 371, 715
FbaI TGATCA 2 cut(s) 367, 544
FblI GTMKAC 2 cut(s) 212, 354
Fnu4HI GCNGC 7 cut(s) 112, 305, 427, 437, 602, 639, 720
FokI GGATG 2 cut(s) 134, 708
FriOI GRGCYC 2 cut(s) 146, 396
Fsp4HI GCNGC 7 cut(s) 112, 305, 427, 437, 602, 639, 720
FspBI CTAG 2 cut(s) 239, 462
GlaI GCGC 3 cut(s) 179, 425, 435
GluI GCNGC 7 cut(s) 112, 305, 427, 437, 602, 639, 720
GsaI CCCAGC 1 cut(s) 472
GsuI CTGGAG 1 cut(s) 594
HaeIII GGCC 1 cut(s) 16
HapII CCGG 4 cut(s) 13, 136, 396, 408
HgaI GACGC 1 cut(s) 474
HhaI GCGC 3 cut(s) 180, 426, 436
Hin1II CATG 1 cut(s) 737
Hin6I GCGC 3 cut(s) 178, 424, 434
HinP1I GCGC 3 cut(s) 178, 424, 434
HincII GTYRAC 1 cut(s) 348
HindII GTYRAC 1 cut(s) 348
HinfI GANTC 3 cut(s) 264, 473, 648
HpaII CCGG 4 cut(s) 13, 136, 396, 408
HphI GGTGA 1 cut(s) 519
Hpy166II GTNNAC 4 cut(s) 213, 348, 355, 739
Hpy188I TCNGA 4 cut(s) 288, 318, 455, 666
Hpy188III TCNNGA 3 cut(s) 268, 462, 652
Hpy8I GTNNAC 4 cut(s) 213, 348, 355, 739
Hpy99I CGWCG 2 cut(s) 222, 362
HpyAV CCTTC 3 cut(s) 529, 649, 823
HpyCH4III ACNGT 3 cut(s) 48, 352, 706
HpyCH4IV ACGT 2 cut(s) 209, 220
HpyCH4V TGCA 5 cut(s) 104, 158, 617, 719, 790
HpyF10VI GCNNNNNNNGC 4 cut(s) 117, 379, 456, 465
HpyF3I CTNAG 2 cut(s) 62, 174
HpySE526I ACGT 2 cut(s) 209, 220
Hsp92II CATG 1 cut(s) 737
HspAI GCGC 3 cut(s) 178, 424, 434
Ksp22I TGATCA 2 cut(s) 367, 544
Kzo9I GATC 6 cut(s) 318, 367, 399, 410, 544, 661
LmnI GCTCC 1 cut(s) 149
Lsp1109I GCAGC 3 cut(s) 123, 625, 731
LweI GCATC 1 cut(s) 459
MaeI CTAG 2 cut(s) 239, 462
MaeII ACGT 2 cut(s) 209, 220
MalI GATC 6 cut(s) 320, 369, 401, 412, 546, 663
MbiI CCGCTC 1 cut(s) 188
MboI GATC 6 cut(s) 318, 367, 399, 410, 544, 661
MfeI CAATTG 1 cut(s) 628
MhlI GDGCHC 2 cut(s) 146, 396
MluCI AATT 3 cut(s) 84, 99, 628
MlyI GAGTC 1 cut(s) 482
MnlI CCTC 7 cut(s) 125, 264, 290, 331, 535, 660, 686
MseI TTAA 4 cut(s) 33, 77, 588, 606
MspA1I CMGCKG 2 cut(s) 61, 722
MspI CCGG 4 cut(s) 13, 136, 396, 408
MspR9I CCNGG 5 cut(s) 13, 18, 396, 397, 408
MunI CAATTG 1 cut(s) 628
MvaI CCWGG 1 cut(s) 18
MvnI CGCG 4 cut(s) 217, 304, 424, 434
MwoI GCNNNNNNNGC 4 cut(s) 117, 379, 456, 465
NciI CCSGG 4 cut(s) 13, 396, 397, 408
NdeII GATC 6 cut(s) 318, 367, 399, 410, 544, 661
NlaIII CATG 1 cut(s) 737
NspI RCATGY 1 cut(s) 737
PciI ACATGT 1 cut(s) 733
PfeI GAWTC 2 cut(s) 264, 648
PflFI GACNNNGTC 1 cut(s) 704
PkrI GCNGC 7 cut(s) 113, 306, 428, 438, 603, 640, 721
PleI GAGTC 1 cut(s) 481
PpsI GAGTC 1 cut(s) 481
PscI ACATGT 1 cut(s) 733
PsiI TTATAA 1 cut(s) 560
Psp124BI GAGCTC 1 cut(s) 146
Psp6I CCWGG 1 cut(s) 16
PspFI CCCAGC 1 cut(s) 468
PspGI CCWGG 1 cut(s) 16
PsrI GAACNNNNNNTAC 2 cut(s) 720, 752
PstNI CAGNNNCTG 1 cut(s) 117
PsyI GACNNNGTC 1 cut(s) 704
SacI GAGCTC 1 cut(s) 146
SaqAI TTAA 4 cut(s) 33, 77, 588, 606
SatI GCNGC 7 cut(s) 112, 305, 427, 437, 602, 639, 720
Sau3AI GATC 6 cut(s) 318, 367, 399, 410, 544, 661
SchI GAGTC 1 cut(s) 482
ScrFI CCNGG 5 cut(s) 13, 18, 396, 397, 408
SduI GDGCHC 2 cut(s) 146, 396
SfaNI GCATC 1 cut(s) 459
SmaI CCCGGG 1 cut(s) 397
Sse9I AATT 3 cut(s) 84, 99, 628
SspMI CTAG 2 cut(s) 239, 462
SstI GAGCTC 1 cut(s) 146
StyD4I CCNGG 5 cut(s) 11, 16, 394, 395, 406
TaaI ACNGT 3 cut(s) 48, 352, 706
TaiI ACGT 2 cut(s) 212, 223
TaqI TCGA 5 cut(s) 50, 476, 497, 759, 802
TasI AATT 3 cut(s) 84, 99, 628
TauI GCSGC 4 cut(s) 307, 429, 439, 604
TfiI GAWTC 2 cut(s) 264, 648
Tru1I TTAA 4 cut(s) 33, 77, 588, 606
Tru9I TTAA 4 cut(s) 33, 77, 588, 606
TscAI CASTG 4 cut(s) 577, 709, 792, 814
TseI GCWGC 3 cut(s) 111, 638, 719
TspMI CCCGGG 1 cut(s) 395
TspRI CASTG 4 cut(s) 577, 709, 792, 814
Tth111I GACNNNGTC 1 cut(s) 704
XapI RAATTY 1 cut(s) 84
XbaI TCTAGA 1 cut(s) 461
XceI RCATGY 1 cut(s) 737
XmaI CCCGGG 1 cut(s) 395
XmiI GTMKAC 2 cut(s) 212, 354
XspI CTAG 2 cut(s) 239, 462
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.