Rmu_sc0006757.1_g000003

f-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006757.1
OG0031377
Physical Location & Seq
Reverse (-)
11144 .. 11425
282 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 282 bp
atgcttaccccatcaactctatataaagcttatcttgtgtacaagtttactgaaagtgcatggggatttgacaactatcctgtggtggtggcggtttctgcaagggattatggctttgattatgaaagccctagtttgagagaaattgttgatggaggagacctaaagcacactgcctttctggtgcatcccgagagaggaatcagtgatgatcagcattttccaaaggaaacagcagagggctggttggagatgaagcaaccagaccgtgcaagggattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PP2

Protein Analysis

93

Amino Acids

10.67

Weight (kDa)

4.9

Isoelectric Point (pI)

34.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP2 PF14299 1 - 86 8.4e-07 Phloem protein 2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031377)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0006757.1_g000003 Rmu_sc0023110.1_g000004

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 92
AfaI GTAC 1 cut(s) 41
AfiI CCNNNNNNNGG 2 cut(s) 197, 274
AluBI AGCT 1 cut(s) 29
AluI AGCT 1 cut(s) 29
Alw26I GTCTC 1 cut(s) 153
Ama87I CYCGRG 1 cut(s) 191
AvaI CYCGRG 1 cut(s) 191
BccI CCATC 2 cut(s) 19, 146
BclI TGATCA 1 cut(s) 211
BcoDI GTCTC 1 cut(s) 153
BfaI CTAG 1 cut(s) 132
BmeT110I CYCGRG 1 cut(s) 191
BmsI GCATC 1 cut(s) 196
BsaI GGTCTC 1 cut(s) 153
Bsc4I CCNNNNNNNGG 2 cut(s) 197, 274
BseGI GGATG 1 cut(s) 187
BseLI CCNNNNNNNGG 2 cut(s) 197, 274
BseRI GAGGAG 1 cut(s) 171
BsiHKCI CYCGRG 1 cut(s) 191
BslI CCNNNNNNNGG 2 cut(s) 197, 274
BsmAI GTCTC 1 cut(s) 153
Bso31I GGTCTC 1 cut(s) 153
BsoBI CYCGRG 1 cut(s) 191
Bsp1407I TGTACA 1 cut(s) 39
Bsp143I GATC 1 cut(s) 211
BspACI CCGC 1 cut(s) 92
BspTNI GGTCTC 1 cut(s) 153
BsrGI TGTACA 1 cut(s) 39
BssMI GATC 1 cut(s) 211
Bst4CI ACNGT 1 cut(s) 269
BstAUI TGTACA 1 cut(s) 39
BstF5I GGATG 1 cut(s) 187
BstKTI GATC 1 cut(s) 214
BstMAI GTCTC 1 cut(s) 153
BstMBI GATC 1 cut(s) 211
BstMWI GCNNNNNNNGC 1 cut(s) 98
BtsCI GGATG 1 cut(s) 187
BtsI GCAGTG 1 cut(s) 171
BtsIMutI CAGTG 2 cut(s) 171, 211
Csp6I GTAC 1 cut(s) 40
CviAII CATG 1 cut(s) 60
CviJI RGCY 4 cut(s) 29, 114, 129, 243
CviKI_1 RGCY 4 cut(s) 29, 114, 129, 243
CviQI GTAC 1 cut(s) 40
DpnI GATC 1 cut(s) 213
DpnII GATC 1 cut(s) 211
Eco31I GGTCTC 1 cut(s) 153
Eco88I CYCGRG 1 cut(s) 191
FaeI CATG 1 cut(s) 63
FaiI YATR 5 cut(s) 22, 24, 61, 111, 123
FalI AAGNNNNNCTT 2 cut(s) 18, 50
FatI CATG 1 cut(s) 59
FbaI TGATCA 1 cut(s) 211
FokI GGATG 1 cut(s) 174
FspBI CTAG 1 cut(s) 132
Hin1II CATG 1 cut(s) 63
HindIII AAGCTT 1 cut(s) 27
HinfI GANTC 1 cut(s) 201
Hpy166II GTNNAC 2 cut(s) 40, 48
Hpy188III TCNNGA 1 cut(s) 191
Hpy8I GTNNAC 2 cut(s) 40, 48
HpyCH4III ACNGT 1 cut(s) 269
HpyCH4V TGCA 4 cut(s) 59, 101, 187, 272
HpyF10VI GCNNNNNNNGC 1 cut(s) 98
Hsp92II CATG 1 cut(s) 63
Ksp22I TGATCA 1 cut(s) 211
Kzo9I GATC 1 cut(s) 211
LpnPI CCDG 4 cut(s) 93, 167, 229, 276
LweI GCATC 1 cut(s) 196
MaeI CTAG 1 cut(s) 132
MalI GATC 1 cut(s) 213
MboI GATC 1 cut(s) 211
MluCI AATT 1 cut(s) 144
MmeI TCCRAC 1 cut(s) 228
MnlI CCTC 3 cut(s) 149, 191, 232
MwoI GCNNNNNNNGC 1 cut(s) 98
NdeII GATC 1 cut(s) 211
NlaIII CATG 1 cut(s) 63
PfeI GAWTC 1 cut(s) 201
RsaI GTAC 1 cut(s) 41
RsaNI GTAC 1 cut(s) 40
Sau3AI GATC 1 cut(s) 211
SetI ASST 2 cut(s) 31, 165
SfaNI GCATC 1 cut(s) 196
Sse9I AATT 1 cut(s) 144
SsiI CCGC 1 cut(s) 92
SspMI CTAG 1 cut(s) 132
TaaI ACNGT 1 cut(s) 269
TasI AATT 1 cut(s) 144
TatI WGTACW 1 cut(s) 39
TfiI GAWTC 1 cut(s) 201
TscAI CASTG 2 cut(s) 178, 211
TspDTI ATGAA 2 cut(s) 138, 269
TspRI CASTG 2 cut(s) 178, 211
XspI CTAG 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.