Rmu_sc0007032.1_g000001

Haloacid dehalogenase-like hydrolase domain-containing protein Sgpp

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007032.1
Physical Location & Seq
Reverse (-)
1 .. 509
509 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007032.1_g000001.1.cds

Sequence Viewer

Length: 167 bp
atgcttcaagaagtaggttttaatggtggggttcctatcactgaggaattcttcattgagaatatcagtgggatgcacaatgaggagctctgtggtgttctctttcctgattgggatctccaaagagcaagaaatttttttgaagataaggaagacatgttccgaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.5

Weight (kDa)

4.19

Isoelectric Point (pI)

79.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029575)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0343761
rosa_multiflora Rmu_sc0007032.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 123
AcsI RAATTY 2 cut(s) 47, 133
AflIII ACRYGT 1 cut(s) 156
AgsI TTSAA 2 cut(s) 8, 143
AloI GAACNNNNNNTCC 1 cut(s) 143
AluBI AGCT 1 cut(s) 88
AluI AGCT 1 cut(s) 88
Alw21I GWGCWC 1 cut(s) 90
AlwI GGATC 1 cut(s) 123
ApoI RAATTY 2 cut(s) 47, 133
BanII GRGCYC 1 cut(s) 90
BbsI GAAGAC 1 cut(s) 159
Bbv12I GWGCWC 1 cut(s) 90
BmiI GGNNCC 1 cut(s) 33
BmsI GCATC 1 cut(s) 63
BpiI GAAGAC 1 cut(s) 159
BsaBI GATNNNNATC 1 cut(s) 114
Bse8I GATNNNNATC 1 cut(s) 114
BseGI GGATG 1 cut(s) 78
BseJI GATNNNNATC 1 cut(s) 114
BseMII CTCAG 1 cut(s) 33
BseRI GAGGAG 1 cut(s) 98
BsiHKAI GWGCWC 1 cut(s) 90
Bsp1286I GDGCHC 1 cut(s) 90
Bsp143I GATC 1 cut(s) 115
BspCNI CTCAG 1 cut(s) 34
BspLI GGNNCC 1 cut(s) 33
BspPI GGATC 1 cut(s) 123
BssMI GATC 1 cut(s) 115
BstDEI CTNAG 1 cut(s) 42
BstF5I GGATG 1 cut(s) 78
BstKTI GATC 1 cut(s) 118
BstMBI GATC 1 cut(s) 115
BstNSI RCATGY 1 cut(s) 160
BstV2I GAAGAC 1 cut(s) 159
BstX2I RGATCY 1 cut(s) 115
BstYI RGATCY 1 cut(s) 115
BtsCI GGATG 1 cut(s) 78
BtsIMutI CAGTG 2 cut(s) 39, 73
CviAII CATG 1 cut(s) 157
CviJI RGCY 1 cut(s) 88
CviKI_1 RGCY 1 cut(s) 88
DdeI CTNAG 1 cut(s) 42
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
Ecl136II GAGCTC 1 cut(s) 88
Eco24I GRGCYC 1 cut(s) 90
Eco53kI GAGCTC 1 cut(s) 88
EcoICRI GAGCTC 1 cut(s) 88
EcoRI GAATTC 1 cut(s) 47
EcoT38I GRGCYC 1 cut(s) 90
FaeI CATG 1 cut(s) 160
FaiI YATR 1 cut(s) 158
FatI CATG 1 cut(s) 156
FokI GGATG 1 cut(s) 85
FriOI GRGCYC 1 cut(s) 90
Hin1II CATG 1 cut(s) 160
Hpy188I TCNGA 1 cut(s) 164
Hpy188III TCNNGA 2 cut(s) 8, 107
HpyCH4V TGCA 1 cut(s) 76
HpyF3I CTNAG 1 cut(s) 42
Hsp92II CATG 1 cut(s) 160
Kzo9I GATC 1 cut(s) 115
LmnI GCTCC 1 cut(s) 85
LpnPI CCDG 1 cut(s) 120
LweI GCATC 1 cut(s) 63
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MboII GAAGA 3 cut(s) 43, 155, 164
MflI RGATCY 1 cut(s) 115
MhlI GDGCHC 1 cut(s) 90
MluCI AATT 2 cut(s) 47, 133
MnlI CCTC 2 cut(s) 37, 76
MseI TTAA 1 cut(s) 21
NdeII GATC 1 cut(s) 115
NlaIII CATG 1 cut(s) 160
NlaIV GGNNCC 1 cut(s) 33
NspI RCATGY 1 cut(s) 160
PciI ACATGT 1 cut(s) 156
PscI ACATGT 1 cut(s) 156
Psp124BI GAGCTC 1 cut(s) 90
PspN4I GGNNCC 1 cut(s) 33
PsuI RGATCY 1 cut(s) 115
SacI GAGCTC 1 cut(s) 90
SaqAI TTAA 1 cut(s) 21
Sau3AI GATC 1 cut(s) 115
SduI GDGCHC 1 cut(s) 90
SetI ASST 2 cut(s) 19, 90
SfaNI GCATC 1 cut(s) 63
SgeI CNNG 3 cut(s) 20, 119, 141
Sse9I AATT 2 cut(s) 47, 133
SstI GAGCTC 1 cut(s) 90
TasI AATT 2 cut(s) 47, 133
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TscAI CASTG 2 cut(s) 46, 73
TspDTI ATGAA 1 cut(s) 43
TspRI CASTG 2 cut(s) 46, 73
XapI RAATTY 2 cut(s) 47, 133
XceI RCATGY 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.