Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007641.1

Orthogroup ID

OG0025504

Physical Location & Seq

Genomic Coordinates Reverse (-)

19830 .. 20525

Gene Structure 696 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007641.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 696 bp

atggaaccacgaactctgcaactaatggagcttcaaacccagcaacacatggaactacaacaacagcaaccaactgaggagggaggaagcaaccaagcagccgggagtagtgccaacacgcctatcagaccaaccaataaccggtgggctcccacaccagctcaactgagaatcctccaggagctttactacgacagggcgcttaaaaacccaactccagagcagattcaagggatctgtctccatctgaagccatatgggcagatcgagaacaaaaacgttttcttttggttccagaacctcaaagctcgtgagaggcagaagttgaaggaaattcggaacgttcgggttggtggatccctcgatctcaaatttggatccacaagtgctactgatggtggcagatccatagatctcaacttcggttccaccgattctactggtgatgatggatcgatcgatctaacccttgggttacaatcattcatggaacgacgaggaggagatcaccaagatgtcgagactcttcctctgttccctgagcacggtgaagacatccttggtaacccgaagactacatccgaggaagttaacacatttggttactattcaggtggctcaggcagttacaacagtggctcacctgtttctcttgagctcagcctcaatccattcggagccgctgacctagcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0001763 GO:0003006 GO:0003674 GO:0003700 GO:0006355 GO:0007275 GO:0008150 GO:0009653 GO:0009791 GO:0009888 GO:0009889 GO:0009908 GO:0009933 GO:0009987 GO:0010014 GO:0010016 GO:0010223 GO:0010346 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0019827 GO:0022412 GO:0022414 GO:0031323 GO:0031326 GO:0032501 GO:0032502 GO:0032504 GO:0048367 GO:0048437 GO:0048438 GO:0048443 GO:0048466 GO:0048507 GO:0048532 GO:0048608 GO:0048646 GO:0048653 GO:0048731 GO:0048827 GO:0048856 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0061458 GO:0065007 GO:0080090 GO:0080166 GO:0090506 GO:0090567 GO:0098727 GO:0099402 GO:0140110 GO:1903506 GO:1905393 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Homeobox

Protein Analysis

231

Amino Acids

25.47

Weight (kDa)

4.96

Isoelectric Point (pI)

51.97

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025504)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0001209.1_g000015 Rmu_sc0001621.1_g000009 Rmu_sc0007641.1_g000003

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	681
AclI	AACGTT	2 cut(s)	279, 342
AclWI	GGATC	7 cut(s)	242, 351, 364, 372, 385, 399, 460
AcsI	RAATTY	2 cut(s)	333, 371
AcuI	CTGAAG	1 cut(s)	269
AfiI	CCNNNNNNNGG	2 cut(s)	141, 545
AgeI	ACCGGT	1 cut(s)	141
AgsI	TTSAA	3 cut(s)	35, 230, 328
AjnI	CCWGG	1 cut(s)	177
AjuI	GAANNNNNNNTTGG	2 cut(s)	543, 575
AluBI	AGCT	6 cut(s)	31, 161, 184, 308, 658, 692
AluI	AGCT	6 cut(s)	31, 161, 184, 308, 658, 692
Alw21I	GWGCWC	2 cut(s)	546, 660
Alw26I	GTCTC	2 cut(s)	245, 515
AlwI	GGATC	7 cut(s)	242, 351, 364, 372, 385, 399, 460
ApeKI	GCWGC	1 cut(s)	98
ApoI	RAATTY	2 cut(s)	333, 371
AsiGI	ACCGGT	1 cut(s)	141
AspLEI	GCGC	1 cut(s)	202
AsuC2I	CCSGG	1 cut(s)	103
AsuHPI	GGTGA	4 cut(s)	455, 500, 560, 633
BamHI	GGATCC	2 cut(s)	356, 377
BanII	GRGCYC	2 cut(s)	151, 660
BauI	CACGAG	1 cut(s)	309
BbsI	GAAGAC	2 cut(s)	558, 578
Bbv12I	GWGCWC	2 cut(s)	546, 660
BbvI	GCAGC	1 cut(s)	110
BccI	CCATC	3 cut(s)	252, 389, 443
BciT130I	CCWGG	1 cut(s)	179
BcnI	CCSGG	1 cut(s)	103
BcoDI	GTCTC	2 cut(s)	245, 515
BfaI	CTAG	1 cut(s)	689
BfoI	RGCGCY	1 cut(s)	203
BglI	GCCNNNNNGGC	1 cut(s)	259
BglII	AGATCT	1 cut(s)	412
BisI	GCNGC	2 cut(s)	99, 681
BlpI	GCTNAGC	1 cut(s)	659
BlsI	GCNGC	2 cut(s)	100, 682
Bme1390I	CCNGG	2 cut(s)	103, 179
BmiI	GGNNCC	7 cut(s)	6, 150, 293, 358, 379, 427, 679
BmrFI	CCNGG	2 cut(s)	103, 179
BpiI	GAAGAC	2 cut(s)	558, 578
BpmI	CTGGAG	2 cut(s)	161, 201
Bpu10I	CCTNAGC	2 cut(s)	540, 619
Bpu1102I	GCTNAGC	1 cut(s)	659
BpuEI	CTTGAG	1 cut(s)	674
BpuMI	CCSGG	1 cut(s)	103
Bsa29I	ATCGAT	2 cut(s)	455, 459
BsaJI	CCNNGG	3 cut(s)	469, 559, 582
BsaWI	WCCGGW	1 cut(s)	141
Bsc4I	CCNNNNNNNGG	2 cut(s)	141, 545
Bse118I	RCCGGY	1 cut(s)	141
Bse1I	ACTGG	1 cut(s)	445
BseBI	CCWGG	1 cut(s)	179
BseCI	ATCGAT	2 cut(s)	455, 459
BseDI	CCNNGG	3 cut(s)	469, 559, 582
BseGI	GGATG	2 cut(s)	555, 578
BseLI	CCNNNNNNNGG	2 cut(s)	141, 545
BseMII	CTCAG	5 cut(s)	66, 158, 531, 633, 673
BseNI	ACTGG	1 cut(s)	445
BseRI	GAGGAG	3 cut(s)	92, 513, 516
BseXI	GCAGC	1 cut(s)	110
BseYI	CCCAGC	1 cut(s)	39
Bsh1285I	CGRYCG	1 cut(s)	459
BshTI	ACCGGT	1 cut(s)	141
BshVI	ATCGAT	2 cut(s)	455, 459
BsiEI	CGRYCG	1 cut(s)	459
BsiHKAI	GWGCWC	2 cut(s)	546, 660
BsiSI	CCGG	2 cut(s)	102, 142
BslI	CCNNNNNNNGG	2 cut(s)	141, 545
BsmAI	GTCTC	2 cut(s)	245, 515
Bsp1286I	GDGCHC	3 cut(s)	151, 546, 660
Bsp1720I	GCTNAGC	1 cut(s)	659
BspACI	CCGC	1 cut(s)	681
BspCNI	CTCAG	5 cut(s)	67, 159, 532, 632, 672
BspDI	ATCGAT	2 cut(s)	455, 459
BspLI	GGNNCC	7 cut(s)	6, 150, 293, 358, 379, 427, 679
BspPI	GGATC	7 cut(s)	242, 351, 364, 372, 385, 399, 460
BsrFI	RCCGGY	1 cut(s)	141
BsrI	ACTGG	1 cut(s)	445
BssAI	RCCGGY	1 cut(s)	141
BssECI	CCNNGG	3 cut(s)	469, 559, 582
BssSI	CACGAG	1 cut(s)	309
BssT1I	CCWWGG	2 cut(s)	469, 559
Bst2BI	CACGAG	1 cut(s)	309
Bst2UI	CCWGG	1 cut(s)	179
Bst4CI	ACNGT	2 cut(s)	548, 635
Bst6I	CTCTTC	1 cut(s)	531
BstDEI	CTNAG	6 cut(s)	75, 167, 540, 619, 659, 693
BstEII	GGTNACC	1 cut(s)	563
BstF5I	GGATG	2 cut(s)	555, 578
BstH2I	RGCGCY	1 cut(s)	203
BstHHI	GCGC	1 cut(s)	202
BstMAI	GTCTC	2 cut(s)	245, 515
BstMCI	CGRYCG	1 cut(s)	459
BstMWI	GCNNNNNNNGC	2 cut(s)	259, 689
BstNI	CCWGG	1 cut(s)	179
BstPI	GGTNACC	1 cut(s)	563
BstSCI	CCNGG	2 cut(s)	101, 177
BstV1I	GCAGC	1 cut(s)	110
BstV2I	GAAGAC	2 cut(s)	558, 578
BstX2I	RGATCY	5 cut(s)	234, 356, 377, 404, 412
BstYI	RGATCY	5 cut(s)	234, 356, 377, 404, 412
Bsu15I	ATCGAT	2 cut(s)	455, 459
BsuTUI	ATCGAT	2 cut(s)	455, 459
BtsCI	GGATG	2 cut(s)	555, 578
BtsIMutI	CAGTG	1 cut(s)	640
CfoI	GCGC	1 cut(s)	202
Cfr10I	RCCGGY	1 cut(s)	141
ClaI	ATCGAT	2 cut(s)	455, 459
CspAI	ACCGGT	1 cut(s)	141
CviAII	CATG	2 cut(s)	49, 487
DdeI	CTNAG	6 cut(s)	75, 167, 540, 619, 659, 693
Eam1104I	CTCTTC	1 cut(s)	531
EarI	CTCTTC	1 cut(s)	531
Ecl136II	GAGCTC	1 cut(s)	658
Eco130I	CCWWGG	2 cut(s)	469, 559
Eco24I	GRGCYC	2 cut(s)	151, 660
Eco53kI	GAGCTC	1 cut(s)	658
Eco57I	CTGAAG	1 cut(s)	269
Eco91I	GGTNACC	1 cut(s)	563
EcoICRI	GAGCTC	1 cut(s)	658
EcoO65I	GGTNACC	1 cut(s)	563
EcoRII	CCWGG	1 cut(s)	177
EcoT14I	CCWWGG	2 cut(s)	469, 559
EcoT38I	GRGCYC	2 cut(s)	151, 660
ErhI	CCWWGG	2 cut(s)	469, 559
FaeI	CATG	2 cut(s)	52, 490
FaiI	YATR	5 cut(s)	50, 256, 258, 410, 488
FalI	AAGNNNNNCTT	2 cut(s)	543, 575
FatI	CATG	2 cut(s)	48, 486
FauNDI	CATATG	1 cut(s)	256
Fnu4HI	GCNGC	2 cut(s)	99, 681
FokI	GGATG	2 cut(s)	542, 565
FriOI	GRGCYC	2 cut(s)	151, 660
Fsp4HI	GCNGC	2 cut(s)	99, 681
FspBI	CTAG	1 cut(s)	689
GlaI	GCGC	1 cut(s)	201
GluI	GCNGC	2 cut(s)	99, 681
GsaI	CCCAGC	1 cut(s)	43
GsuI	CTGGAG	2 cut(s)	161, 201
HaeII	RGCGCY	1 cut(s)	203
HapII	CCGG	2 cut(s)	102, 142
HhaI	GCGC	1 cut(s)	202
Hin1II	CATG	2 cut(s)	52, 490
Hin6I	GCGC	1 cut(s)	200
HinP1I	GCGC	1 cut(s)	200
HincII	GTYRAC	1 cut(s)	592
HindII	GTYRAC	1 cut(s)	592
HinfI	GANTC	4 cut(s)	171, 226, 434, 523
HpaI	GTTAAC	1 cut(s)	592
HpaII	CCGG	2 cut(s)	102, 142
HphI	GGTGA	4 cut(s)	455, 500, 560, 633
Hpy166II	GTNNAC	1 cut(s)	592
Hpy188I	TCNGA	5 cut(s)	128, 249, 339, 583, 677
Hpy188III	TCNNGA	6 cut(s)	218, 268, 295, 311, 520, 653
Hpy8I	GTNNAC	1 cut(s)	592
Hpy99I	CGWCG	1 cut(s)	498
HpyAV	CCTTC	1 cut(s)	322
HpyCH4III	ACNGT	2 cut(s)	548, 635
HpyCH4IV	ACGT	2 cut(s)	279, 342
HpyCH4V	TGCA	1 cut(s)	19
HpyF10VI	GCNNNNNNNGC	2 cut(s)	259, 689
HpyF3I	CTNAG	6 cut(s)	75, 167, 540, 619, 659, 693
HpySE526I	ACGT	2 cut(s)	279, 342
Hsp92II	CATG	2 cut(s)	52, 490
HspAI	GCGC	1 cut(s)	200
KspAI	GTTAAC	1 cut(s)	592
LmnI	GCTCC	4 cut(s)	28, 154, 181, 677
Lsp1109I	GCAGC	1 cut(s)	110
MaeI	CTAG	1 cut(s)	689
MaeII	ACGT	2 cut(s)	279, 342
MaeIII	GTNAC	4 cut(s)	474, 563, 602, 626
MboII	GAAGA	3 cut(s)	518, 563, 583
MflI	RGATCY	5 cut(s)	234, 356, 377, 404, 412
MhlI	GDGCHC	3 cut(s)	151, 546, 660
MluCI	AATT	2 cut(s)	333, 371
MlyI	GAGTC	1 cut(s)	517
MseI	TTAA	2 cut(s)	204, 591
MslI	CAYNNNNRTG	1 cut(s)	513
MspA1I	CMGCKG	1 cut(s)	683
MspI	CCGG	2 cut(s)	102, 142
MspR9I	CCNGG	2 cut(s)	103, 179
MvaI	CCWGG	1 cut(s)	179
MwoI	GCNNNNNNNGC	2 cut(s)	259, 689
NciI	CCSGG	1 cut(s)	103
NdeI	CATATG	1 cut(s)	256
NlaIII	CATG	2 cut(s)	52, 490
NlaIV	GGNNCC	7 cut(s)	6, 150, 293, 358, 379, 427, 679
PcsI	WCGNNNNNNNCGW	1 cut(s)	429
PfeI	GAWTC	3 cut(s)	171, 226, 434
PfoI	TCCNGGA	1 cut(s)	177
PinAI	ACCGGT	1 cut(s)	141
PkrI	GCNGC	2 cut(s)	100, 682
Ple19I	CGATCG	1 cut(s)	459
PleI	GAGTC	1 cut(s)	517
PpsI	GAGTC	1 cut(s)	517
Psp124BI	GAGCTC	1 cut(s)	660
Psp1406I	AACGTT	2 cut(s)	279, 342
Psp6I	CCWGG	1 cut(s)	177
PspEI	GGTNACC	1 cut(s)	563
PspFI	CCCAGC	1 cut(s)	39
PspGI	CCWGG	1 cut(s)	177
PspN4I	GGNNCC	7 cut(s)	6, 150, 293, 358, 379, 427, 679
PsuI	RGATCY	5 cut(s)	234, 356, 377, 404, 412
PvuI	CGATCG	1 cut(s)	459
RseI	CAYNNNNRTG	1 cut(s)	513
SacI	GAGCTC	1 cut(s)	660
SaqAI	TTAA	2 cut(s)	204, 591
SatI	GCNGC	2 cut(s)	99, 681
SchI	GAGTC	1 cut(s)	517
ScrFI	CCNGG	2 cut(s)	103, 179
SduI	GDGCHC	3 cut(s)	151, 546, 660
SmiMI	CAYNNNNRTG	1 cut(s)	513
SmlI	CTYRAG	1 cut(s)	653
SmoI	CTYRAG	1 cut(s)	653
Sse9I	AATT	2 cut(s)	333, 371
SsiI	CCGC	1 cut(s)	681
SspMI	CTAG	1 cut(s)	689
SstI	GAGCTC	1 cut(s)	660
StyD4I	CCNGG	2 cut(s)	101, 177
StyI	CCWWGG	2 cut(s)	469, 559
TaaI	ACNGT	2 cut(s)	548, 635
TaiI	ACGT	2 cut(s)	282, 345
TaqI	TCGA	5 cut(s)	267, 363, 455, 459, 519
TasI	AATT	2 cut(s)	333, 371
TauI	GCSGC	1 cut(s)	683
TfiI	GAWTC	3 cut(s)	171, 226, 434
Tru1I	TTAA	2 cut(s)	204, 591
Tru9I	TTAA	2 cut(s)	204, 591
TscAI	CASTG	1 cut(s)	640
TseI	GCWGC	1 cut(s)	98
TspDTI	ATGAA	1 cut(s)	475
TspRI	CASTG	1 cut(s)	640
XapI	RAATTY	2 cut(s)	333, 371
XspI	CTAG	1 cut(s)	689

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.