Rmu_sc0008040.1_g000014

pyrophosphate-energized membrane proton pump

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008040.1
OG0029490
Physical Location & Seq
Reverse (-)
47398 .. 49068
1671 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008040.1_g000014.1.cds

Sequence Viewer

Length: 747 bp
atgctcatgggtggcgatttggaggatggtaatttggggccttaccaagacaggctgaggacatttccaaacatgcgtggtaaatcttacaacccattgatttttcgaattttgaggcgaataaatgttcgtgtcctttttgtgattttgcttctggcacttggagtggtcttttacattggagcaagcacttctcctatcattgtgttcgtcttctcagtttgtattatcagcttccttctggcaatgcaccttgccaaatgggttcttgcaaaagatgagggacctccggagatgggtcagatatcagatgcaatacgtgatggagctgaaggtttcttcaggacccagtatgggaccatctctaagatggcatttttactggctgcggttatcctttgcatatacttatttcgcactacgactcctcagcaagagtcatctggccttggaagggtagccactgcatgtattactgtagctgcatttcttttgggagctttctgttcaggtattgcagggtatgtcgggatgtgggtatcagttcgtgccaatgttcgagtctctagtgctgcgagacggtctgcaagggaggcattgcagatagctgttcgtgctggtggtttttctgctatgattgtcgttggtatggctgtaatcggtattgccatcctgtattccacattttatgtctggctgggagtggatacaccgggttcaatgaaggttactgactgtatgttttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00190 map00190
Pfam Domains
Protein Families
H_PPase

Protein Analysis

248

Amino Acids

26.94

Weight (kDa)

9.5

Isoelectric Point (pI)

36.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029490)

Species Orthologous Gene IDs
pyrus_communis pycom17g15390
rosa_multiflora Rmu_sc0008040.1_g000014

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 289
AciI CCGC 1 cut(s) 389
AcsI RAATTY 1 cut(s) 108
AcuI CTGAAG 2 cut(s) 325, 351
AfiI CCNNNNNNNGG 3 cut(s) 296, 354, 454
AgsI TTSAA 1 cut(s) 720
AluBI AGCT 5 cut(s) 234, 329, 482, 500, 608
AluI AGCT 5 cut(s) 234, 329, 482, 500, 608
Alw26I GTCTC 2 cut(s) 568, 571
Aor13HI TCCGGA 1 cut(s) 289
AoxI GGCC 2 cut(s) 38, 445
ApeKI GCWGC 3 cut(s) 386, 482, 572
ApoI RAATTY 1 cut(s) 108
AspS9I GGNCC 4 cut(s) 38, 284, 345, 357
AsuC2I CCSGG 1 cut(s) 714
AsuII TTCGAA 1 cut(s) 106
AvaII GGWCC 3 cut(s) 284, 345, 357
BbsI GAAGAC 1 cut(s) 205
BbvCI CCTCAGC 2 cut(s) 56, 429
BbvI GCAGC 3 cut(s) 373, 469, 559
BccI CCATC 6 cut(s) 20, 289, 317, 364, 368, 677
BciVI GTATCC 1 cut(s) 700
BcnI CCSGG 1 cut(s) 714
BcoDI GTCTC 2 cut(s) 568, 571
BfaI CTAG 1 cut(s) 567
BfmI CTRYAG 1 cut(s) 477
BfuI GTATCC 1 cut(s) 700
BisI GCNGC 3 cut(s) 387, 483, 573
BlsI GCNGC 3 cut(s) 388, 484, 574
Bme1390I CCNGG 1 cut(s) 714
Bme18I GGWCC 3 cut(s) 284, 345, 357
BmgT120I GGNCC 4 cut(s) 38, 284, 345, 357
BmiI GGNNCC 4 cut(s) 39, 285, 347, 358
BmrFI CCNGG 1 cut(s) 714
BmrI ACTGGG 1 cut(s) 343
BmsI GCATC 1 cut(s) 301
BmuI ACTGGG 1 cut(s) 343
BpiI GAAGAC 1 cut(s) 205
Bpu10I CCTNAGC 2 cut(s) 56, 429
Bpu14I TTCGAA 1 cut(s) 106
BpuMI CCSGG 1 cut(s) 714
BsaAI YACGTR 1 cut(s) 320
BsaJI CCNNGG 1 cut(s) 448
BsaWI WCCGGW 1 cut(s) 289
BsaXI ACNNNNNCTCC 2 cut(s) 409, 439
Bsc4I CCNNNNNNNGG 3 cut(s) 296, 354, 454
Bse1I ACTGG 2 cut(s) 349, 387
Bse3DI GCAATG 2 cut(s) 252, 596
BseAI TCCGGA 1 cut(s) 289
BseDI CCNNGG 1 cut(s) 448
BseGI GGATG 3 cut(s) 31, 537, 669
BseLI CCNNNNNNNGG 3 cut(s) 296, 354, 454
BseMI GCAATG 2 cut(s) 252, 596
BseMII CTCAG 3 cut(s) 47, 231, 443
BseNI ACTGG 2 cut(s) 349, 387
BseRI GAGGAG 1 cut(s) 417
BseXI GCAGC 3 cut(s) 373, 469, 559
BseYI CCCAGC 1 cut(s) 697
BshFI GGCC 2 cut(s) 40, 447
BsiSI CCGG 2 cut(s) 290, 713
BslFI GGGAC 2 cut(s) 297, 370
BslI CCNNNNNNNGG 3 cut(s) 296, 354, 454
BsmAI GTCTC 2 cut(s) 568, 571
BsmBI CGTCTC 1 cut(s) 571
BsmFI GGGAC 2 cut(s) 297, 370
BsnI GGCC 2 cut(s) 40, 447
Bsp119I TTCGAA 1 cut(s) 106
Bsp13I TCCGGA 1 cut(s) 289
BspACI CCGC 1 cut(s) 389
BspANI GGCC 2 cut(s) 40, 447
BspCNI CTCAG 3 cut(s) 48, 230, 442
BspEI TCCGGA 1 cut(s) 289
BspLI GGNNCC 4 cut(s) 39, 285, 347, 358
BspT104I TTCGAA 1 cut(s) 106
BsrDI GCAATG 2 cut(s) 252, 596
BsrI ACTGG 2 cut(s) 349, 387
BssECI CCNNGG 1 cut(s) 448
BssT1I CCWWGG 1 cut(s) 448
Bst4CI ACNGT 3 cut(s) 478, 582, 737
BstBAI YACGTR 1 cut(s) 320
BstBI TTCGAA 1 cut(s) 106
BstC8I GCNNGC 1 cut(s) 187
BstDEI CTNAG 4 cut(s) 56, 217, 366, 429
BstF5I GGATG 3 cut(s) 31, 537, 669
BstMAI GTCTC 2 cut(s) 568, 571
BstMWI GCNNNNNNNGC 2 cut(s) 593, 614
BstNSI RCATGY 2 cut(s) 76, 471
BstSCI CCNGG 1 cut(s) 712
BstSFI CTRYAG 1 cut(s) 477
BstV1I GCAGC 3 cut(s) 373, 469, 559
BstV2I GAAGAC 1 cut(s) 205
BsuI GTATCC 1 cut(s) 700
BsuRI GGCC 2 cut(s) 40, 447
BtsCI GGATG 3 cut(s) 31, 537, 669
BtsI GCAGTG 1 cut(s) 462
BtsIMutI CAGTG 1 cut(s) 462
Cac8I GCNNGC 1 cut(s) 187
Cfr13I GGNCC 4 cut(s) 38, 284, 345, 357
CviAII CATG 3 cut(s) 7, 73, 468
DdeI CTNAG 4 cut(s) 56, 217, 366, 429
Eco130I CCWWGG 1 cut(s) 448
Eco32I GATATC 1 cut(s) 306
Eco47I GGWCC 3 cut(s) 284, 345, 357
Eco57I CTGAAG 2 cut(s) 325, 351
EcoO109I RGGNCCY 3 cut(s) 38, 284, 345
EcoRV GATATC 1 cut(s) 306
EcoT14I CCWWGG 1 cut(s) 448
ErhI CCWWGG 1 cut(s) 448
Esp3I CGTCTC 1 cut(s) 571
FaeI CATG 3 cut(s) 10, 76, 471
FaqI GGGAC 2 cut(s) 297, 370
FatI CATG 3 cut(s) 6, 72, 467
Fnu4HI GCNGC 3 cut(s) 387, 483, 573
FokI GGATG 3 cut(s) 38, 544, 656
Fsp4HI GCNGC 3 cut(s) 387, 483, 573
FspBI CTAG 1 cut(s) 567
GluI GCNGC 3 cut(s) 387, 483, 573
GsaI CCCAGC 1 cut(s) 701
HaeIII GGCC 2 cut(s) 40, 447
HapII CCGG 2 cut(s) 290, 713
Hin1II CATG 3 cut(s) 10, 76, 471
HinfI GANTC 3 cut(s) 424, 437, 561
HpaII CCGG 2 cut(s) 290, 713
Hpy188I TCNGA 2 cut(s) 303, 310
Hpy188III TCNNGA 3 cut(s) 290, 343, 529
HpyAV CCTTC 4 cut(s) 248, 326, 447, 718
HpyCH4III ACNGT 3 cut(s) 478, 582, 737
HpyCH4IV ACGT 1 cut(s) 319
HpyCH4V TGCA 9 cut(s) 250, 272, 314, 402, 467, 485, 518, 587, 601
HpyF10VI GCNNNNNNNGC 2 cut(s) 593, 614
HpyF3I CTNAG 4 cut(s) 56, 217, 366, 429
HpySE526I ACGT 1 cut(s) 319
Hsp92II CATG 3 cut(s) 10, 76, 471
Kpn2I TCCGGA 1 cut(s) 289
LmnI GCTCC 3 cut(s) 182, 326, 497
Lsp1109I GCAGC 3 cut(s) 373, 469, 559
LweI GCATC 1 cut(s) 301
MaeI CTAG 1 cut(s) 567
MaeII ACGT 1 cut(s) 319
MaeIII GTNAC 1 cut(s) 727
MboII GAAGA 2 cut(s) 205, 331
MluCI AATT 2 cut(s) 31, 108
MlyI GAGTC 3 cut(s) 418, 446, 570
MnlI CCTC 7 cut(s) 16, 51, 108, 274, 297, 438, 586
MroI TCCGGA 1 cut(s) 289
MspI CCGG 2 cut(s) 290, 713
MspR9I CCNGG 1 cut(s) 714
MwoI GCNNNNNNNGC 2 cut(s) 593, 614
NciI CCSGG 1 cut(s) 714
NlaIII CATG 3 cut(s) 10, 76, 471
NlaIV GGNNCC 4 cut(s) 39, 285, 347, 358
NspI RCATGY 2 cut(s) 76, 471
NspV TTCGAA 1 cut(s) 106
PkrI GCNGC 3 cut(s) 388, 484, 574
PleI GAGTC 3 cut(s) 418, 445, 569
PpsI GAGTC 3 cut(s) 418, 445, 569
Ppu21I YACGTR 1 cut(s) 320
PpuMI RGGWCCY 2 cut(s) 284, 345
Psp5II RGGWCCY 2 cut(s) 284, 345
PspFI CCCAGC 1 cut(s) 697
PspN4I GGNNCC 4 cut(s) 39, 285, 347, 358
PspPI GGNCC 4 cut(s) 38, 284, 345, 357
PspPPI RGGWCCY 2 cut(s) 284, 345
SatI GCNGC 3 cut(s) 387, 483, 573
Sau96I GGNCC 4 cut(s) 38, 284, 345, 357
SchI GAGTC 3 cut(s) 418, 446, 570
ScrFI CCNGG 1 cut(s) 714
SfaNI GCATC 1 cut(s) 301
SfcI CTRYAG 1 cut(s) 477
SfuI TTCGAA 1 cut(s) 106
SinI GGWCC 3 cut(s) 284, 345, 357
Sse9I AATT 2 cut(s) 31, 108
SsiI CCGC 1 cut(s) 389
SspMI CTAG 1 cut(s) 567
StyD4I CCNGG 1 cut(s) 712
StyI CCWWGG 1 cut(s) 448
TaaI ACNGT 3 cut(s) 478, 582, 737
TaiI ACGT 1 cut(s) 322
TaqI TCGA 2 cut(s) 106, 559
TasI AATT 2 cut(s) 31, 108
TscAI CASTG 1 cut(s) 469
TseI GCWGC 3 cut(s) 386, 482, 572
TspDTI ATGAA 1 cut(s) 737
TspRI CASTG 1 cut(s) 469
VpaK11BI GGWCC 3 cut(s) 284, 345, 357
XapI RAATTY 1 cut(s) 108
XceI RCATGY 2 cut(s) 76, 471
XcmI CCANNNNNNNNNTGG 1 cut(s) 367
XspI CTAG 1 cut(s) 567
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.